View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11453A_low_556 (Length: 230)

Name: NF11453A_low_556
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11453A_low_556
NF11453A_low_556
[»] chr3 (4 HSPs)
chr3 (19-213)||(27004691-27004885)
chr3 (38-158)||(33397498-33397618)
chr3 (23-149)||(36876569-36876695)
chr3 (121-213)||(37579753-37579845)


Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 213
Target Start/End: Complemental strand, 27004885 - 27004691
Alignment:
19 tgagcattaccagatattgttttagggaaactgatatccaattgttggaggaaggggaatgaatctgcgatcaaggatatgggagtgtggcatagagaag 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
27004885 tgagcattaccagatattgttttagggaaactgatatccaattgttggaggaaggggaatgaatctgcgatcaaggatatgtgagtgtggcatagagaag 27004786  T
119 ccatattggaacatgtgagagaggtcaaggtggatttagtagtagtctttttgagaagagtttgcaaccctaagacggggaaggtggtgtggttg 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27004785 ccatattggaacatgtgagagaggtcaaggtggatttagtagtagtctttttgagaagagtttgcaaccctaagacggggaaggtggtgtggttg 27004691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 38 - 158
Target Start/End: Original strand, 33397498 - 33397618
Alignment:
38 ttttagggaaactgatatccaattgttggaggaaggggaatgaatctgcgatcaaggatatgggagtgtggcatagagaagccatattggaacatgtgag 137  Q
    |||||||| ||||||||||||||||||||||||| ||||| ||||| || || |||||||||  ||| ||| |||||||  | || |||||||| |||||    
33397498 ttttagggtaactgatatccaattgttggaggaaagggaaggaatcggcaatgaaggatatgtcagtatggtatagagagccgatgttggaacaagtgag 33397597  T
138 agaggtcaaggtggatttagt 158  Q
    |||||||||||| ||||||||    
33397598 agaggtcaaggttgatttagt 33397618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 23 - 149
Target Start/End: Original strand, 36876569 - 36876695
Alignment:
23 cattaccagatattgttttagggaaactgatatccaattgttggaggaaggggaatgaatctgcgatcaaggatatgggagtgtggcatagagaagccat 122  Q
    ||||||| | ||||||||| |||||||||||||||| |||||||||||| || || ||||  || || |||||||||  ||| ||| |||||||  | ||    
36876569 cattaccggttattgttttggggaaactgatatccagttgttggaggaaaggaaaagaatgagcaatgaaggatatgtcagtatggtatagagagccaat 36876668  T
123 attggaacatgtgagagaggtcaaggt 149  Q
     ||||||||||||||||||||||||||    
36876669 gttggaacatgtgagagaggtcaaggt 36876695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 121 - 213
Target Start/End: Complemental strand, 37579845 - 37579753
Alignment:
121 atattggaacatgtgagagaggtcaaggtggatttagtagtagtctttttgagaagagtttgcaaccctaagacggggaaggtggtgtggttg 213  Q
    ||||| ||||| || |||||||||||||| |||    |||| || |||||||||| ||| ||||||||||| ||||||||||||| |||||||    
37579845 atatttgaacaagtcagagaggtcaaggttgatgatatagtggtgtttttgagaatagtctgcaaccctaatacggggaaggtggggtggttg 37579753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University