View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11453A_low_557 (Length: 230)

Name: NF11453A_low_557
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11453A_low_557
NF11453A_low_557
[»] chr3 (1 HSPs)
chr3 (21-103)||(17944103-17944185)
[»] chr6 (1 HSPs)
chr6 (27-61)||(13664090-13664124)


Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 21 - 103
Target Start/End: Complemental strand, 17944185 - 17944103
Alignment:
21 aaaatgcagggaagacttcagtattttctttacaaatatgtatattattagaacttgttaactttaagcatttgttatcatat 103  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||    
17944185 aaaatgcagggaagacttcagtattttctttacaaatatgtatattgttagaatttgttaactttaagcatttgttatcatat 17944103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 27 - 61
Target Start/End: Original strand, 13664090 - 13664124
Alignment:
27 cagggaagacttcagtattttctttacaaatatgt 61  Q
    |||||||||||||||||||||||||||||||||||    
13664090 cagggaagacttcagtattttctttacaaatatgt 13664124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University