View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_557 (Length: 230)
Name: NF11453A_low_557
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_557 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 21 - 103
Target Start/End: Complemental strand, 17944185 - 17944103
Alignment:
| Q |
21 |
aaaatgcagggaagacttcagtattttctttacaaatatgtatattattagaacttgttaactttaagcatttgttatcatat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17944185 |
aaaatgcagggaagacttcagtattttctttacaaatatgtatattgttagaatttgttaactttaagcatttgttatcatat |
17944103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 27 - 61
Target Start/End: Original strand, 13664090 - 13664124
Alignment:
| Q |
27 |
cagggaagacttcagtattttctttacaaatatgt |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
13664090 |
cagggaagacttcagtattttctttacaaatatgt |
13664124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University