View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_558 (Length: 230)
Name: NF11453A_low_558
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_558 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 31213020 - 31212798
Alignment:
| Q |
1 |
ataattagcttagttttaaaaataactaatttctcatatttgccaattttatccggagctacactctctctagtgcctcgtagctatagctatcccaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31213020 |
ataattagcttagttttaaaaataactaatttctcatatttgccaattttatcctgagctacactctctctagtgcctcgtagctatagctatcccaaac |
31212921 |
T |
|
| Q |
101 |
taaactataaattaaatcaatcttggaatgatttttgtctccctctgtaagaggacagcataaaactagaattagaagatatttgannnnnnnnattaaa |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
31212920 |
taaactatatattaaatcaatcttggaatgatttttgtctccctctgtaagaggacagcataaaactagaatcagaagatatttgattttttttattaaa |
31212821 |
T |
|
| Q |
201 |
tccaacacgttttaataattgtg |
223 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
31212820 |
tccaacacgttttattaattgtg |
31212798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University