View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_563 (Length: 230)
Name: NF11453A_low_563
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_563 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 19 - 130
Target Start/End: Complemental strand, 11626340 - 11626229
Alignment:
| Q |
19 |
actaaggaccctgaaattaagctttttgggaagaagattctttttcctggggagagtgaagctcttatgattgctggtgaggaaaatgtttcgcccgcgg |
118 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11626340 |
actaaggaccctgaaattaagctctttgggaagaagattctttttcctggggaaggtgaagctcttatgattgatggtgaggaaaatgtttcgcccgcgg |
11626241 |
T |
|
| Q |
119 |
cggctatggatg |
130 |
Q |
| |
|
|||||||||||| |
|
|
| T |
11626240 |
cggctatggatg |
11626229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University