View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_571 (Length: 229)
Name: NF11453A_low_571
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_571 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 11 - 229
Target Start/End: Complemental strand, 30574101 - 30573884
Alignment:
| Q |
11 |
ggacatcataagaaggaatacaacaatccgataaaaggtcatggttttattgtgtgaagctcacttaccggttccnnnnnnnnnnnnnnnnaaaaaactc |
110 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30574101 |
ggacatgataagaaggaatacaacaatccgataaaaggtcatggttttattgtgtgaagctcacttaccggttcctttttttttattttt-aaaaaactc |
30574003 |
T |
|
| Q |
111 |
agtatgtgacctaaggaccgactaatccgaaaggtcaaatcccacatcgacttacggggacccttttaaagttagagcaaaactctatatggactatccc |
210 |
Q |
| |
|
| ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30574002 |
aatatctgacctaaggaccgactaatccgaaaggtcaaatcccacatcgacttgtggggacccttttaaagttagagcaaaactctatatggactatccc |
30573903 |
T |
|
| Q |
211 |
accgacctgctgtggaaaa |
229 |
Q |
| |
|
||||| ||||||||||||| |
|
|
| T |
30573902 |
accgaactgctgtggaaaa |
30573884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University