View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_581 (Length: 229)
Name: NF11453A_low_581
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_581 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 6 - 217
Target Start/End: Complemental strand, 11034777 - 11034566
Alignment:
| Q |
6 |
atatatgagttgtccaaatcggatggaatactcatacattggtaattgtatgaatagaacttcacactcacaggatgtgaattctttctatgttggtagc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
11034777 |
atatatgagttgtccaaatcggatggaatactcatacattggtaattgtatgaatagaacttcaaattcacaggatgtgaattctttctatgttggtagc |
11034678 |
T |
|
| Q |
106 |
tatggcaaatctctgtcggaattcgggctgggagatgggtgtcgtatacagtttatgtatctcacttctttggatgttgaagatgatggtgctgatcaca |
205 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11034677 |
tatggtaaatctctgtcggaattcgggctgggagatgggtgtcgtatacagtttatgtatctcacttctttggatgttgaagatgatggtgctgatcaca |
11034578 |
T |
|
| Q |
206 |
acaacaacaaca |
217 |
Q |
| |
|
|||||||||||| |
|
|
| T |
11034577 |
acaacaacaaca |
11034566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 6 - 194
Target Start/End: Complemental strand, 11009364 - 11009179
Alignment:
| Q |
6 |
atatatgagttgtccaaatcggatggaatactcatacattggtaattgtatgaatagaacttcacactcacaggatgtgaattctttctatgttggtagc |
105 |
Q |
| |
|
|||| |||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| || |
|
|
| T |
11009364 |
atatgtgagctgtccgaatcggatggaatattcatacattggtaattgtatgaatagaacttcatattcacaggatgtgaattctttctatgttggtggc |
11009265 |
T |
|
| Q |
106 |
tatggcaaatctctgtcggaattcgggctgggagatgggtgtcgtatacagtttatgtatctcacttctttggatgttgaagatgatgg |
194 |
Q |
| |
|
||||| |||||||||| |||||| ||| ||||||| ||||||| |||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
11009264 |
tatggtaaatctctgttggaatttgggttgggagacgggtgtcatatagagtttatgtatctca---cttgggatgttgaagatgatgg |
11009179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 11 - 190
Target Start/End: Complemental strand, 10975395 - 10975216
Alignment:
| Q |
11 |
tgagttgtccaaatcggatggaatactcatacattggtaattgtatgaatagaacttcacactcacaggatgtgaattctttctatgttggtagctatgg |
110 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||| ||||||| ||||||| ||| |||| ||||||| | | |||| ||||||||||||| |||| | |
|
|
| T |
10975395 |
tgagttgtccaaattggacggaatactcatacgttggtaactgtatgagtagtggttcatactcacaacacgggaatcgtttctatgttggtcgctacag |
10975296 |
T |
|
| Q |
111 |
caaatctctgtcggaattcgggctgggagatgggtgtcgtatacagtttatgtatctcacttctttggatgttgaagatg |
190 |
Q |
| |
|
||||||||| |||||||| | | || ||| |||||| || |||||||||||||||| ||||| || ||||||||| |
|
|
| T |
10975295 |
caaatctctttcggaattggtgttgaaagacacttgtcgtgtagagtttatgtatctcacatctttaaattttgaagatg |
10975216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University