View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_587 (Length: 228)
Name: NF11453A_low_587
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_587 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 52391495 - 52391653
Alignment:
| Q |
1 |
aaaaaatttagcctccaatcatcattagtttttgtaatatcactaataagattccctcttcaagttggaacaggaattctgttccaattttgagagttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52391495 |
aaaaaatttagcctccaatcatcattagtttttgtaatatcactaataagattccctcttcaagttggaacc------ctgttccaattttgagagtttg |
52391588 |
T |
|
| Q |
101 |
aaaggtatgagaagggatggcttcagaggtggaaaatataggagggaatgtggaaatcttgtaca |
165 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52391589 |
aaaggtatgagaagggatgacttcagagttggaaaatataggagggaatgtggaaatcttgtaca |
52391653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University