View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_589 (Length: 228)
Name: NF11453A_low_589
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_589 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 34 - 211
Target Start/End: Original strand, 54428610 - 54428798
Alignment:
| Q |
34 |
cttatttgccatgtcatcagcatttgcaccacttttat-----------tccacactcataacaatatggtattaagttgtgtttagatattgtaatgat |
122 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54428610 |
cttatttgccatgtcatcatcatttgcaccacttttatcaattgggcattccacactcataacaatatggtattaagttgtgtttagatattgtaatgat |
54428709 |
T |
 |
| Q |
123 |
tccctcnnnnnnngatattgtaatgatggatgtataaaaagttatttttgtactaagtaaactctttcaactctagagtgaagtctatg |
211 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54428710 |
tccctcaaaaaaagatattgtaatgatggatgtataagaagttatttttgtactaagtaaactctttcaactctagagtgaagtctatg |
54428798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University