View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11453A_low_592 (Length: 227)

Name: NF11453A_low_592
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11453A_low_592
NF11453A_low_592
[»] chr1 (1 HSPs)
chr1 (19-203)||(17811965-17812148)


Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 19 - 203
Target Start/End: Complemental strand, 17812148 - 17811965
Alignment:
19 ttcctcaccattaatccgagagctccttaccaccccgaggg-ttactcatgtccgtaccccaggcatagatggctggagaagtgaggggttcaagaaaga 117  Q
    ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
17812148 ttcctcaccattaatccgagagctcctcaccaccccgaggggttactcatgtccgtaccccaggaatagatggctggagaagtgaggggttcaagaaaga 17812049  T
118 gagtgtcggagcgcgtgcagtgcaggtacaccatcccccttccagtggagaagaacctgcaacagacgactcaacggaaccatgct 203  Q
    |  |||| |||| | |||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||    
17812048 g--tgtcagagcacatgcagtgcaggtacaccaccccccttccggtggagaagaacctgcaacagacgactcaacggaaccatgct 17811965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University