View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_596 (Length: 227)
Name: NF11453A_low_596
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_596 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 225
Target Start/End: Original strand, 28054032 - 28054239
Alignment:
| Q |
18 |
cttctgttcatttcgaaactttttaccaagttccgaaaccgcagagttttttgcgagtttgtctttggtaggagtgtttgaacttttcggcaggtcgttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28054032 |
cttctgttcatttcgaaactttttaccaagttccgaaaccgcagagttttttgcgagattgactttggtaggagtgtttgaacttttcggcacgtcgttt |
28054131 |
T |
 |
| Q |
118 |
tcaatgcaaaaagtcgtatccgtagatttgactggagattttttgttctcgtgatctaatgtactactctttgaagattcatcgaaccttttttctggaa |
217 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28054132 |
tcagtgcaaaaagtcgtatccgtagatttgactggagattttttcttctcgtgatctaatgtactactctttgaagattcatcgaaccttttctctggaa |
28054231 |
T |
 |
| Q |
218 |
attgccta |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
28054232 |
attgccta |
28054239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University