View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_597 (Length: 226)
Name: NF11453A_low_597
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_597 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 24 - 189
Target Start/End: Complemental strand, 35489919 - 35489754
Alignment:
| Q |
24 |
ggaagtatgattgctatcaaacttggagttagcggtgaaggctcgtttacaaaaaccgaagctgatcttctcttagtctttatatgtctatatgttgcgg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35489919 |
ggaagtatgattgctatcaaacttggagttagcggtgaaggctcgtttacaaaaactgaagctgatcttctcttagtctttatatgtctatatgttgcgg |
35489820 |
T |
|
| Q |
124 |
catttgcatggtcttggggtgcgttgggatggttagttcctagtgaaatatgctctcttgatgtcc |
189 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
35489819 |
catttgcatggtcttggggtgcgctgggatggttagttcccagtgaaatatgctctcttgaagtcc |
35489754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 80 - 181
Target Start/End: Original strand, 14233080 - 14233181
Alignment:
| Q |
80 |
cgaagctgatcttctcttagtctttatatgtctatatgttgcggcatttgcatggtcttggggtgcgttgggatggttagttcctagtgaaatatgctct |
179 |
Q |
| |
|
|||||| || |||||||| ||||||| ||| |||||||||||||||||||||||||||||| | ||||| |||||||| ||||||||||||||| || |
|
|
| T |
14233080 |
cgaagccgaccttctcttgttctttatttgtgcatatgttgcggcatttgcatggtcttggggaccattgggttggttagtgcctagtgaaatatgcgct |
14233179 |
T |
|
| Q |
180 |
ct |
181 |
Q |
| |
|
|| |
|
|
| T |
14233180 |
ct |
14233181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 80 - 181
Target Start/End: Original strand, 14242754 - 14242855
Alignment:
| Q |
80 |
cgaagctgatcttctcttagtctttatatgtctatatgttgcggcatttgcatggtcttggggtgcgttgggatggttagttcctagtgaaatatgctct |
179 |
Q |
| |
|
|||||| || |||||||| ||||||| ||| |||||||||||||||||||||||||||||| | ||||| |||||||| ||||||||| ||||| || |
|
|
| T |
14242754 |
cgaagccgaccttctcttgttctttatttgtgcatatgttgcggcatttgcatggtcttggggaccattgggttggttagtgcctagtgaagtatgcgct |
14242853 |
T |
|
| Q |
180 |
ct |
181 |
Q |
| |
|
|| |
|
|
| T |
14242854 |
ct |
14242855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University