View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_604 (Length: 225)
Name: NF11453A_low_604
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_604 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 24 - 209
Target Start/End: Original strand, 34467024 - 34467209
Alignment:
| Q |
24 |
tgatgaagtttgtgaagccctcagggaaggtgatcatgaatctctaagcattttctttccatagactgcatgcttttatagctttctatactggcctgca |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34467024 |
tgatgaagtttgtgaagccctcagggaaggtgatcatgaatctctaagcattttctttccatagactgcatgcttttatagctttctatactggcctgca |
34467123 |
T |
|
| Q |
124 |
tatgttttagctttccatgtctttcacatatgagaagatgaggttaaggaagaagtattaccatccttgtgagtggccttctaatt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34467124 |
tatgttttagctttccatgtctttcacatatgagaagatgaggttaaggaagaagtattaccatccttgtgagtggctttctaatt |
34467209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University