View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_621 (Length: 223)
Name: NF11453A_low_621
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_621 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 87; Significance: 7e-42; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 120 - 214
Target Start/End: Original strand, 3311002 - 3311096
Alignment:
| Q |
120 |
attcccctagccctgatttatggttactatttatacggtaaattaggttaaaggcattaggaagatgccaattggaaaagggtggagaggtggtt |
214 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3311002 |
attcccctagccttgatttatggttactatttataaggtaaattaggttaaaggcattaggaagatgccaattggaaaagggtggagaggtggtt |
3311096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 7 - 62
Target Start/End: Original strand, 3310886 - 3310941
Alignment:
| Q |
7 |
atggtgatgtgtagaggatggtgaagatatatgtgacaatgtgtttggtttcacta |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3310886 |
atggtgatgtgtagaggatggtgaagatatatgtggcaatgtgtttggtttcacta |
3310941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 10 - 58
Target Start/End: Original strand, 3318678 - 3318726
Alignment:
| Q |
10 |
gtgatgtgtagaggatggtgaagatatatgtgacaatgtgtttggtttc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3318678 |
gtgatgtgtagaggatggtgaagatatatgtggcaatgtgtttggtttc |
3318726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 140 - 214
Target Start/End: Original strand, 3318776 - 3318851
Alignment:
| Q |
140 |
tggttactatttatacggtaaattaggttaaaggcattaggaagatgccaatt--ggaaaagggtggagaggtggtt |
214 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3318776 |
tggttactatttatactagaaattaggttaaa-gcattaggaagatgccaatttattgaaagggtggagaggtggtt |
3318851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University