View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_641 (Length: 220)
Name: NF11453A_low_641
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_641 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 220
Target Start/End: Original strand, 41923017 - 41923221
Alignment:
| Q |
16 |
ggatggagacggggaggattaagagtagagattacaatggatattcacgggaagcaaagtattcatcggctactcacttatgaaataaaattgatattat |
115 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41923017 |
ggatggagacggggagaattaagagtagagattacaatggatattcacgggaagcaaagtattcatcggctactcacttatgaaataaaattgatattat |
41923116 |
T |
|
| Q |
116 |
tgtcaacttcgtattagtcattgttgatgtccgttagatgggtattttacaaattttgaatcatcatcacaaacgtacgtccatcaaactctaaaatagg |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41923117 |
tgtcaacttcgtattagtccttgttgatgtccgttagatgggtattttacaaattttgaatcatcatcacaaacgtacgtccatcaaactctaaaatagg |
41923216 |
T |
|
| Q |
216 |
tggtt |
220 |
Q |
| |
|
||||| |
|
|
| T |
41923217 |
tggtt |
41923221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University