View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_645 (Length: 220)
Name: NF11453A_low_645
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_645 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 3185734 - 3185927
Alignment:
| Q |
18 |
aaaaataagtatagcgggaaagttatagagccaaagtcattaagttcttaagtaaggtaagctcataattaagttggttaatttttcacttttgaataaa |
117 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3185734 |
aaaaataagtatatggtgaaagttatagagccaaagtcattaagttcttaagtaaggtaagctcataattaagttggttaatttttcacttttgaataaa |
3185833 |
T |
 |
| Q |
118 |
caaaagacagccatgtatatataaatatgcaaggagatggaaataaagtaaggttgaagttaagtaacaaaaaataataattttatgatgatgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3185834 |
caaaagacagccatgtatatataaatatgcaaggagatggaaataaagtaaggttgaagttaagtaacaaaaaataataattttatgacgatgt |
3185927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University