View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_650 (Length: 219)
Name: NF11453A_low_650
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_650 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 21 - 203
Target Start/End: Original strand, 42449690 - 42449872
Alignment:
| Q |
21 |
cttacaacacccaagccctcaaacatggatggtagttttgactctcgattcgtggtgaggcacctaactctgttaaatgaatctattactttgatctcaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42449690 |
cttacaacacccaagccctcaaacatggatggtagttttgactctcgattcgtggtgaggcacctaactctgttaaatgaatctattactttgatctcaa |
42449789 |
T |
 |
| Q |
121 |
cttatttaaagaatatgagtacttttcgcatatcaattttgggtaaacttggtgcgagagaatcttggatcaatctctatatt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42449790 |
cttatttaaagaatatgagtacttttcgcatatcaattttgggtaaacttggtgcgagagaatcttggatcaatctctttatt |
42449872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 140 - 203
Target Start/End: Original strand, 42262367 - 42262430
Alignment:
| Q |
140 |
tacttttcgcatatcaattttgggtaaacttggtgcgagagaatcttggatcaatctctatatt |
203 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||| ||||| ||||||| |||| |
|
|
| T |
42262367 |
tacttttcgcttatcaattttgggtaaacttggtgtgagagaatcatggataaatctctttatt |
42262430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University