View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_655 (Length: 219)
Name: NF11453A_low_655
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_655 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 23 - 212
Target Start/End: Original strand, 22443404 - 22443590
Alignment:
| Q |
23 |
aaagtgtcttcggaagaacttaaaataaaaacattgttagtatcctacaagtatctcaatatagaaaagtatctgtgcgttattgggaagtacttgcaaa |
122 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22443404 |
aaagtgtcttcggaa---cttaaaaaaaaaacattgttagtatcctacaagtatctcaatatagaaaagtatctgtgcgttattgggaagtacttgcaaa |
22443500 |
T |
 |
| Q |
123 |
ttatcataataataattcgtaaaataaaatatatttgggtacttttgggacgcatatccagggagtgccagtgtcctatattcttcgaca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22443501 |
ttatcataataataattcgtaaaataaaatatatttgggtacttttgggacgcatatccagggagtgccagtgtcctatatggttcgaca |
22443590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University