View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_656 (Length: 218)
Name: NF11453A_low_656
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_656 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 24 - 201
Target Start/End: Complemental strand, 31457962 - 31457782
Alignment:
| Q |
24 |
tagcggtggttcaaaaggtggtggtggaggtggcgcaaaaggaggcggcggt---ggaagcaaagggtccaccggtggcagtggtggtggggattcaatg |
120 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31457962 |
tagcggtggtgcaaaaggtggtggtggaggtggcgcaaaaggaggcggtggtaccggaagcaaagggtccaccggtggcagtggtggtggggattcaatg |
31457863 |
T |
 |
| Q |
121 |
aaagcaccgggaggtggtggatcatacatatctcgtggtgcatttgaaaacaaccctcaaggctattttagtggtcttcat |
201 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31457862 |
aaagcacctggaggtggtggatcatacatatctcgtggtgcatttgaaaacaaccctcaaggctattttagtggtcttcat |
31457782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 40 - 201
Target Start/End: Complemental strand, 49085892 - 49085731
Alignment:
| Q |
40 |
ggtggtggtggaggtggcgcaaaaggaggcggcggtggaagcaaagggtccaccggtggcagtggtggtggggattcaatgaaagcaccgggaggtggtg |
139 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49085892 |
ggtggtggaggaggtggcacaaaaggaggcggtggtggaagcaaagggtccaccggtggcagtggtggtggagattcaatgaaagcaccgggaggtggtg |
49085793 |
T |
 |
| Q |
140 |
gatcatacatatctcgtggtgcatttgaaaacaaccctcaaggctattttagtggtcttcat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
49085792 |
gatcatacatatctcgtggtgcatttgaaagcaacccacaaggctattttggtggtcttcat |
49085731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University