View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_664 (Length: 215)
Name: NF11453A_low_664
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_664 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 66 - 191
Target Start/End: Original strand, 8637920 - 8638041
Alignment:
| Q |
66 |
ttgggactcatcaagctatatatataggcatataatttgattaagcaaagaacaacgacaacctgttnnnnnnnnccaagaacgacaatgaactcataaa |
165 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8637920 |
ttgggactcatcaagctatata----ggcatataatttgattacgcaaagaacaacgacaacctgttaaaaaaaaccaagaacgacaatgaactcataaa |
8638015 |
T |
|
| Q |
166 |
gatgcactacttcattgcaatcagtc |
191 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
8638016 |
gatgcactacttcattgcaatcagtc |
8638041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 19 - 87
Target Start/End: Complemental strand, 35111777 - 35111709
Alignment:
| Q |
19 |
acttgagggcttatgaagttaaattttctagaagctgcccttttcaattgggactcatcaagctatata |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35111777 |
acttgagggcttatgaagttaaattttctagaagttgcccttttcaattgggactcatcaagctatata |
35111709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 31 - 87
Target Start/End: Original strand, 6757660 - 6757716
Alignment:
| Q |
31 |
atgaagttaaattttctagaagctgcccttttcaattgggactcatcaagctatata |
87 |
Q |
| |
|
||||||||||||||| |||||| | || || |||||||||||||||||||||||||| |
|
|
| T |
6757660 |
atgaagttaaattttatagaagttacctttctcaattgggactcatcaagctatata |
6757716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 141 - 188
Target Start/End: Original strand, 6757736 - 6757783
Alignment:
| Q |
141 |
ccaagaacgacaatgaactcataaagatgcactacttcattgcaatca |
188 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
6757736 |
ccaagaactacaatgaactcataaaggtgcactatttcattgcaatca |
6757783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University