View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11453A_low_676 (Length: 210)

Name: NF11453A_low_676
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11453A_low_676
NF11453A_low_676
[»] chr2 (41 HSPs)
chr2 (13-163)||(19456511-19456661)
chr2 (13-163)||(21703254-21703404)
chr2 (13-163)||(34303393-34303543)
chr2 (13-160)||(27392973-27393120)
chr2 (13-163)||(3784655-3784805)
chr2 (13-163)||(16163600-16163750)
chr2 (13-163)||(34157012-34157162)
chr2 (13-163)||(27118689-27118839)
chr2 (41-163)||(31891446-31891568)
chr2 (41-163)||(28882215-28882337)
chr2 (41-163)||(12655543-12655665)
chr2 (41-163)||(23128684-23128806)
chr2 (13-163)||(27434534-27434684)
chr2 (20-163)||(11635283-11635426)
chr2 (41-163)||(20837919-20838041)
chr2 (41-163)||(21677300-21677422)
chr2 (20-163)||(11641472-11641615)
chr2 (20-163)||(22926125-22926268)
chr2 (20-163)||(34279450-34279593)
chr2 (13-160)||(40233515-40233662)
chr2 (20-163)||(34286355-34286498)
chr2 (20-163)||(34291415-34291558)
chr2 (41-163)||(34861681-34861803)
chr2 (41-163)||(37686027-37686149)
chr2 (41-163)||(37701292-37701414)
chr2 (41-163)||(37925494-37925616)
chr2 (41-163)||(31876282-31876404)
chr2 (20-162)||(37375163-37375305)
chr2 (63-160)||(13936684-13936781)
chr2 (41-163)||(16829456-16829578)
chr2 (41-163)||(16891903-16892025)
chr2 (41-163)||(32049799-32049921)
chr2 (41-163)||(39890075-39890197)
chr2 (63-160)||(12716742-12716839)
chr2 (63-160)||(27777226-27777323)
chr2 (63-160)||(27803711-27803808)
chr2 (63-160)||(27816984-27817081)
chr2 (63-160)||(39051962-39052059)
chr2 (20-154)||(260850-260984)
chr2 (63-160)||(9350122-9350219)
chr2 (63-160)||(12586814-12586911)
[»] chr1 (7 HSPs)
chr1 (20-163)||(20461085-20461228)
chr1 (13-163)||(16208132-16208282)
chr1 (13-163)||(20340436-20340586)
chr1 (13-163)||(28151866-28152016)
chr1 (20-163)||(41793416-41793559)
chr1 (41-163)||(28584985-28585107)
chr1 (41-163)||(10962674-10962796)
[»] chr7 (33 HSPs)
chr7 (13-163)||(16449985-16450135)
chr7 (13-163)||(16041329-16041479)
chr7 (13-163)||(26484700-26484850)
chr7 (13-163)||(2108992-2109142)
chr7 (13-163)||(2775365-2775515)
chr7 (13-163)||(31088451-31088601)
chr7 (13-163)||(39211010-39211160)
chr7 (13-163)||(45733466-45733616)
chr7 (21-163)||(18540805-18540947)
chr7 (41-163)||(11424791-11424913)
chr7 (20-163)||(5127998-5128141)
chr7 (41-163)||(10916883-10917005)
chr7 (41-163)||(16503395-16503517)
chr7 (41-163)||(16518431-16518553)
chr7 (20-163)||(5147334-5147477)
chr7 (41-163)||(2154579-2154701)
chr7 (20-163)||(16736454-16736597)
chr7 (20-163)||(16751508-16751651)
chr7 (20-163)||(17523538-17523681)
chr7 (20-163)||(17529534-17529677)
chr7 (41-163)||(4145138-4145260)
chr7 (41-163)||(9618657-9618779)
chr7 (41-163)||(26275109-26275231)
chr7 (41-163)||(26319884-26320006)
chr7 (41-163)||(45387349-45387471)
chr7 (41-160)||(3445315-3445434)
chr7 (20-163)||(26435263-26435406)
chr7 (41-163)||(26669929-26670051)
chr7 (41-162)||(31564405-31564526)
chr7 (41-160)||(26537885-26538004)
chr7 (41-154)||(11441587-11441700)
chr7 (41-162)||(31124927-31125048)
chr7 (21-163)||(5159525-5159667)
[»] scaffold0558 (1 HSPs)
scaffold0558 (13-163)||(129-279)
[»] chr4 (24 HSPs)
chr4 (13-163)||(15227890-15228040)
chr4 (13-163)||(15285029-15285179)
chr4 (13-163)||(1900277-1900427)
chr4 (13-163)||(24460706-24460856)
chr4 (13-160)||(15391439-15391586)
chr4 (13-163)||(14235626-14235776)
chr4 (20-163)||(17014020-17014163)
chr4 (20-163)||(14763412-14763555)
chr4 (41-163)||(24592443-24592565)
chr4 (41-163)||(14098561-14098683)
chr4 (41-163)||(14665038-14665160)
chr4 (20-163)||(5005893-5006036)
chr4 (20-163)||(6569873-6570016)
chr4 (41-163)||(27163446-27163568)
chr4 (41-162)||(18800742-18800863)
chr4 (41-160)||(30753777-30753896)
chr4 (41-163)||(31126647-31126769)
chr4 (20-160)||(33673906-33674046)
chr4 (20-162)||(36344623-36344765)
chr4 (41-163)||(40105767-40105889)
chr4 (21-163)||(24112682-24112824)
chr4 (21-163)||(34189069-34189211)
chr4 (20-162)||(54833408-54833550)
chr4 (63-160)||(39850661-39850758)
[»] scaffold0124 (2 HSPs)
scaffold0124 (13-163)||(20393-20543)
scaffold0124 (41-88)||(30532-30579)
[»] chr3 (60 HSPs)
chr3 (13-163)||(16626648-16626798)
chr3 (13-163)||(18530354-18530504)
chr3 (13-163)||(4625910-4626060)
chr3 (13-163)||(31034259-31034409)
chr3 (13-163)||(32292718-32292868)
chr3 (13-163)||(17993926-17994076)
chr3 (13-163)||(5652353-5652503)
chr3 (41-163)||(15892876-15892998)
chr3 (41-163)||(8295938-8296060)
chr3 (41-163)||(8301437-8301559)
chr3 (41-163)||(18330635-18330757)
chr3 (20-163)||(4721597-4721740)
chr3 (20-163)||(22387727-22387870)
chr3 (41-163)||(4796823-4796945)
chr3 (41-163)||(15741264-15741386)
chr3 (41-163)||(17985126-17985248)
chr3 (41-163)||(18051228-18051350)
chr3 (41-162)||(6542632-6542753)
chr3 (20-163)||(5609471-5609614)
chr3 (20-163)||(6192282-6192425)
chr3 (20-163)||(18277201-18277344)
chr3 (20-163)||(18292502-18292645)
chr3 (20-163)||(18307803-18307946)
chr3 (20-163)||(28339268-28339411)
chr3 (20-163)||(29148904-29149047)
chr3 (20-163)||(31964622-31964765)
chr3 (20-163)||(50134220-50134363)
chr3 (41-163)||(35880732-35880854)
chr3 (20-163)||(4416885-4417028)
chr3 (41-160)||(5713196-5713315)
chr3 (41-160)||(5724106-5724225)
chr3 (41-160)||(5757252-5757371)
chr3 (41-160)||(5768143-5768262)
chr3 (20-163)||(10396099-10396242)
chr3 (20-163)||(28116103-28116246)
chr3 (41-160)||(36997247-36997366)
chr3 (41-163)||(7996528-7996650)
chr3 (41-163)||(10643036-10643158)
chr3 (41-163)||(47023419-47023541)
chr3 (20-163)||(7073178-7073321)
chr3 (20-163)||(21674659-21674802)
chr3 (20-160)||(11110498-11110638)
chr3 (20-163)||(4346836-4346979)
chr3 (41-162)||(18242706-18242827)
chr3 (41-161)||(5466953-5467073)
chr3 (20-160)||(48465896-48466036)
chr3 (20-163)||(22871005-22871148)
chr3 (20-163)||(22886064-22886207)
chr3 (20-163)||(28021241-28021384)
chr3 (41-100)||(51782052-51782111)
chr3 (21-163)||(4893176-4893318)
chr3 (41-154)||(5013687-5013800)
chr3 (41-162)||(5596527-5596648)
chr3 (63-160)||(20577039-20577136)
chr3 (63-160)||(29665162-29665259)
chr3 (63-162)||(20066010-20066109)
chr3 (49-100)||(51797141-51797192)
chr3 (20-154)||(8211713-8211847)
chr3 (41-163)||(18225157-18225279)
chr3 (21-163)||(32439120-32439262)
[»] scaffold0260 (1 HSPs)
scaffold0260 (13-163)||(2759-2909)
[»] chr5 (49 HSPs)
chr5 (13-163)||(22888484-22888634)
chr5 (13-163)||(25199043-25199193)
chr5 (13-163)||(23892220-23892370)
chr5 (13-163)||(13184646-13184796)
chr5 (13-163)||(33877261-33877411)
chr5 (13-163)||(11325808-11325958)
chr5 (13-163)||(13440492-13440642)
chr5 (13-163)||(29889080-29889230)
chr5 (20-163)||(23752455-23752598)
chr5 (41-163)||(11549368-11549490)
chr5 (41-163)||(23718014-23718136)
chr5 (41-163)||(30934647-30934769)
chr5 (41-163)||(24688183-24688305)
chr5 (41-163)||(24970032-24970154)
chr5 (20-163)||(33777501-33777644)
chr5 (41-163)||(2511065-2511187)
chr5 (41-163)||(8665501-8665623)
chr5 (41-163)||(15758883-15759005)
chr5 (20-163)||(6874319-6874462)
chr5 (20-163)||(9548548-9548691)
chr5 (20-163)||(22999119-22999262)
chr5 (41-163)||(26480406-26480528)
chr5 (20-162)||(37671488-37671630)
chr5 (20-163)||(15658765-15658908)
chr5 (20-163)||(41674723-41674866)
chr5 (41-163)||(5637924-5638046)
chr5 (41-163)||(9317465-9317587)
chr5 (41-163)||(12132169-12132291)
chr5 (20-162)||(18500735-18500877)
chr5 (20-162)||(28649250-28649392)
chr5 (41-163)||(30152032-30152154)
chr5 (41-163)||(30168483-30168605)
chr5 (41-163)||(34616532-34616654)
chr5 (41-154)||(31431463-31431576)
chr5 (41-160)||(31826433-31826552)
chr5 (41-163)||(18375438-18375560)
chr5 (41-163)||(28959812-28959934)
chr5 (20-162)||(37770992-37771134)
chr5 (41-162)||(37358669-37358790)
chr5 (20-163)||(32599477-32599620)
chr5 (41-162)||(3789556-3789677)
chr5 (41-162)||(37754995-37755116)
chr5 (20-160)||(43078269-43078409)
chr5 (21-163)||(33292539-33292681)
chr5 (41-163)||(33516370-33516492)
chr5 (63-160)||(24681457-24681554)
chr5 (63-160)||(24723984-24724081)
chr5 (63-160)||(40473597-40473694)
chr5 (21-162)||(13324835-13324976)
[»] chr6 (46 HSPs)
chr6 (13-163)||(22456978-22457128)
chr6 (13-163)||(22477317-22477467)
chr6 (13-163)||(27290414-27290564)
chr6 (13-163)||(8892354-8892504)
chr6 (13-163)||(8903589-8903739)
chr6 (13-163)||(13522117-13522267)
chr6 (13-163)||(14143329-14143479)
chr6 (13-163)||(26787946-26788096)
chr6 (13-163)||(27196319-27196469)
chr6 (13-163)||(27252771-27252921)
chr6 (13-163)||(33374300-33374450)
chr6 (13-163)||(28162659-28162809)
chr6 (15-162)||(20160704-20160851)
chr6 (15-162)||(22171980-22172127)
chr6 (13-163)||(22934924-22935074)
chr6 (13-163)||(23857369-23857519)
chr6 (13-160)||(27272624-27272771)
chr6 (20-163)||(26918382-26918525)
chr6 (41-163)||(13299023-13299145)
chr6 (41-163)||(24304690-24304812)
chr6 (41-163)||(26989003-26989125)
chr6 (20-163)||(16749856-16749999)
chr6 (41-163)||(15424389-15424511)
chr6 (41-163)||(24863719-24863841)
chr6 (41-163)||(27000075-27000197)
chr6 (41-162)||(4525289-4525410)
chr6 (20-163)||(29549477-29549620)
chr6 (41-162)||(4773009-4773130)
chr6 (41-160)||(3696086-3696205)
chr6 (41-163)||(29573015-29573137)
chr6 (41-154)||(4545847-4545960)
chr6 (41-154)||(4724206-4724319)
chr6 (41-162)||(4757767-4757888)
chr6 (41-154)||(28207465-28207578)
chr6 (20-160)||(16674144-16674284)
chr6 (20-160)||(34463397-34463537)
chr6 (20-162)||(27007730-27007872)
chr6 (20-162)||(27044390-27044532)
chr6 (41-162)||(27485132-27485253)
chr6 (41-163)||(26777687-26777809)
chr6 (41-163)||(30558088-30558210)
chr6 (41-162)||(26116482-26116603)
chr6 (41-162)||(27360064-27360185)
chr6 (41-162)||(27450407-27450528)
chr6 (41-162)||(29501418-29501539)
chr6 (63-162)||(17025280-17025379)
[»] chr8 (21 HSPs)
chr8 (13-163)||(44563106-44563256)
chr8 (13-163)||(9354627-9354777)
chr8 (13-163)||(19659099-19659249)
chr8 (13-160)||(22080938-22081085)
chr8 (13-163)||(33244670-33244820)
chr8 (13-163)||(16283454-16283604)
chr8 (41-163)||(16277559-16277681)
chr8 (41-163)||(2137347-2137469)
chr8 (41-163)||(19688103-19688225)
chr8 (41-163)||(27608993-27609115)
chr8 (20-163)||(31354529-31354672)
chr8 (41-163)||(14557629-14557751)
chr8 (41-163)||(19208448-19208570)
chr8 (41-163)||(31489838-31489960)
chr8 (20-163)||(19674446-19674589)
chr8 (41-163)||(28362043-28362165)
chr8 (41-162)||(3329595-3329716)
chr8 (20-163)||(18710591-18710734)
chr8 (41-162)||(12092812-12092933)
chr8 (20-162)||(19286468-19286610)
chr8 (40-162)||(29829328-29829450)
[»] scaffold0109 (1 HSPs)
scaffold0109 (13-160)||(21569-21716)
[»] scaffold0415 (2 HSPs)
scaffold0415 (13-98)||(2018-2103)
scaffold0415 (20-100)||(6080-6160)
[»] scaffold0143 (1 HSPs)
scaffold0143 (41-163)||(27297-27419)
[»] scaffold0089 (3 HSPs)
scaffold0089 (41-163)||(29768-29890)
scaffold0089 (41-163)||(40198-40320)
scaffold0089 (41-163)||(47114-47236)
[»] scaffold0159 (2 HSPs)
scaffold0159 (41-163)||(9195-9317)
scaffold0159 (41-163)||(20020-20142)
[»] scaffold0029 (1 HSPs)
scaffold0029 (41-163)||(258-381)
[»] scaffold0350 (1 HSPs)
scaffold0350 (41-163)||(7368-7490)
[»] scaffold0144 (1 HSPs)
scaffold0144 (48-163)||(26338-26453)
[»] scaffold0237 (1 HSPs)
scaffold0237 (41-163)||(15059-15181)
[»] scaffold0038 (1 HSPs)
scaffold0038 (41-154)||(7963-8076)
[»] scaffold0336 (1 HSPs)
scaffold0336 (20-163)||(9571-9714)


Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 41)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 19456511 - 19456661
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  19456511 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctatgagaagtagagt 19456610  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  19456611 cgggagtaactcggcatatagcattggtatcggaggaaaggtaggtctagc 19456661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 21703254 - 21703404
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  21703254 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgtcctgtctggttgtgcagtgccctctgagaagtagagt 21703353  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||||||||| ||||| | ||||||||||||||| || |||||||||||    
T  21703354 cgggagtaactcagcatacaacattggtatcggagggaaggtaggtctagc 21703404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 34303393 - 34303543
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  34303393 gatggaaatcacacttgaggtccgaacggaacttgggaggcgacggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 34303492  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  34303493 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 34303543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 13 - 160
Target Start/End: Complemental strand, 27393120 - 27392973
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| ||||||| | |||    
T  27393120 gatggaaatcgcacttgaggtcagaatggaacctgggaggcaacgggttaggtggaggcttgccctgcctggttgtgcagtgccctttgagaagcaaagt 27393021  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    |||||| | ||||||||| | |||||||||||||||||| ||||||||    
T  27393020 cgggagcagctcggcatacatcattggtatcggaggaaaggtaggtct 27392973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 3784805 - 3784655
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  3784805 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 3784706  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  3784705 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 3784655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 16163750 - 16163600
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  16163750 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 16163651  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  16163650 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 16163600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 34157162 - 34157012
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  34157162 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 34157063  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  34157062 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 34157012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 27118839 - 27118689
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  27118839 gatggaaatcacacttgaggtccgaacggaacttgggaggcgacggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 27118740  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| || ||||| | ||| ||||||||||| || |||||||||||    
T  27118739 cgggagtaattcagcatacaacatcggtatcggagggaaggtaggtctagc 27118689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 31891446 - 31891568
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||| |||||||    
T  31891446 gaaccttggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagtaattcagcatataacattggt 31891545  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    ||| ||||||| |||||||||||    
T  31891546 atcagaggaaaggtaggtctagc 31891568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 28882337 - 28882215
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  28882337 gaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 28882238  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  28882237 atcggagggaaagtaggtctagc 28882215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 12655665 - 12655543
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  12655665 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 12655566  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  12655565 atcggagggaaagtaggtctagc 12655543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 23128684 - 23128806
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  23128684 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 23128783  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  23128784 atcggagggaaagtaggtctagc 23128806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 27434534 - 27434684
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| |||||||| ||   |||| ||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||     
T  27434534 gatggaaatcacatttgaggtcggacctgaacttgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagc 27434633  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||| || ||||| ||||| | ||| ||||||||||| ||||||||||||||    
T  27434634 cggaagcaactcagcatacaacatcggtatcggagggaaagtaggtctagc 27434684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 11635283 - 11635426
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  11635283 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 11635382  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  11635383 aactcagcatataacatcggtatcggagggaaagtaggtctagc 11635426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 20838041 - 20837919
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||||||||||||| ||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  20838041 gaacctgggaggcaacagatcaggtgggggcttgccctgtctagttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 20837942  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  20837941 atcggagggaaagtaggtctagc 20837919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 21677300 - 21677422
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  21677300 gaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 21677399  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  21677400 atcggagggaaagtaggcctagc 21677422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 11641472 - 11641615
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  11641472 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 11641571  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| |||  |||||||||| ||||||||||||||    
T  11641572 aactcagcatataacatctgtatcggagggaaagtaggtctagc 11641615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 22926125 - 22926268
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  22926125 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 22926224  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  22926225 aactcagcatataacatcggtatcggagggaaagtaggcctagc 22926268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 34279593 - 34279450
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  34279593 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 34279494  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  34279493 aactcagcatataacatcggtatcggagggaaagtaggtctagc 34279450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 13 - 160
Target Start/End: Complemental strand, 40233662 - 40233515
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| |||||||||||  ||||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| |||    
T  40233662 gatggaaatcacatttgaggtcagaccggaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagt 40233563  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
     || || | ||| ||||| | ||||||||| ||||||||||| |||||    
T  40233562 tggaagaagctcagcatacaacattggtataggaggaaaagttggtct 40233515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 34286498 - 34286355
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  34286498 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 34286399  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||| ||||| ||||||||||||||    
T  34286398 aactcagcatataacatcggtattggagggaaagtaggtctagc 34286355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 34291558 - 34291415
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  34291558 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 34291459  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||| ||||| ||||||||||||||    
T  34291458 aactcagcatataacatcggtattggagggaaagtaggtctagc 34291415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 34861803 - 34861681
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  34861803 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 34861704  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  34861703 atcggagggaaagtaggcctagc 34861681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 37686027 - 37686149
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  37686027 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 37686126  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  37686127 atcggagggaaagtaggcctagc 37686149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 37701292 - 37701414
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  37701292 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 37701391  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  37701392 atcggagggaaagtaggcctagc 37701414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 37925616 - 37925494
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||| |  ||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| |||||||    
T  37925616 gaaccttggaggcaacgggtcgggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacattggt 37925517  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  37925516 atcggagggaaagtaggcctagc 37925494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 31876404 - 31876282
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || || |  || || || | |||||||    
T  31876404 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaagaagttccgcgtacaacattggt 31876305  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    || |||||||||||||| |||||    
T  31876304 ataggaggaaaagtaggcctagc 31876282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 20 - 162
Target Start/End: Complemental strand, 37375305 - 37375163
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  37375305 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 37375206  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctag 162  Q
    | ||| ||||| | ||| ||||| ||||||||||| |||||||    
T  37375205 agctctgcatacaacataggtataggaggaaaagttggtctag 37375163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 63 - 160
Target Start/End: Original strand, 13936684 - 13936781
Alignment:
Q  63 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||||||||| |||||||||||    
T  13936684 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtatcggagggaaagtaggtct 13936781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 16829456 - 16829578
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | ||||  || || || |  || ||||| | |||||||    
T  16829456 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtaaggttggaagaagttctgcatacaacattggt 16829555  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    || |||||||||||||| |||||    
T  16829556 ataggaggaaaagtaggcctagc 16829578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 16892025 - 16891903
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | ||||  || || || |  || ||||| | |||||||    
T  16892025 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtaaggttggaagaagttctgcatacaacattggt 16891926  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    || |||||||||||||| |||||    
T  16891925 ataggaggaaaagtaggcctagc 16891903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 32049921 - 32049799
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||| |  ||||| || || |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  32049921 gaaccttggaggcaacgggtccggtgggggtttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 32049822  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  32049821 atcggagggaaagtaggcctagc 32049799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 39890197 - 39890075
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | ||||  || || || |  || ||||| | |||||||    
T  39890197 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtaaggttggaagaagttctgcatacaacattggt 39890098  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    || ||||||||||| ||||||||    
T  39890097 ataggaggaaaagttggtctagc 39890075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 63 - 160
Target Start/End: Original strand, 12716742 - 12716839
Alignment:
Q  63 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  12716742 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 12716839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 63 - 160
Target Start/End: Complemental strand, 27777323 - 27777226
Alignment:
Q  63 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  27777323 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 27777226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 63 - 160
Target Start/End: Complemental strand, 27803808 - 27803711
Alignment:
Q  63 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  27803808 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 27803711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 63 - 160
Target Start/End: Complemental strand, 27817081 - 27816984
Alignment:
Q  63 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  27817081 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 27816984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 63 - 160
Target Start/End: Original strand, 39051962 - 39052059
Alignment:
Q  63 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  39051962 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 39052059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 154
Target Start/End: Original strand, 260850 - 260984
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||| ||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  260850 atcacatttgagatcagacctgaaccttggaggcaacagatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 260949  T
Q  120 aactcggcatatagcattggtatcggaggaaaagt 154  Q
    |  || ||||| | ||||||||| |||||||||||    
T  260950 agttctgcatacaacattggtataggaggaaaagt 260984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 63 - 160
Target Start/End: Original strand, 9350122 - 9350219
Alignment:
Q  63 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    |||||||||||||| || || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  9350122 ggtggaggcttgccttgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 9350219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 63 - 160
Target Start/End: Complemental strand, 12586911 - 12586814
Alignment:
Q  63 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || ||  |||| ||||||| ||| ||||| ||||||||||| |||||    
T  12586911 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcgactcagcatataacatcggtataggaggaaaagttggtct 12586814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 7)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 20461228 - 20461085
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20461228 atcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 20461129  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||||||||||||||| ||||||||||||| |||||||||||    
T  20461128 aactcggcatatagcattagtatcggaggaaaggtaggtctagc 20461085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 16208132 - 16208282
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||||||||    
T  16208132 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggttttccctgtctggttgtgcagtgccctctgagaagtagagt 16208231  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||||||||||| ||| | |||||||||||||||||| |||||||||||    
T  16208232 cgggagtaactcggtatacaacattggtatcggaggaaaggtaggtctagc 16208282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 20340436 - 20340586
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||||||| ||||||| ||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  20340436 gatggaaatcacacttgaggtcagaacggaacctaggaggtaacggatcaggtggaggcttgccctgtctggttgtgtagtgccctctgagaagtagagt 20340535  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
     ||||||| |||||||||||||||||||||||||||||| |||||||||||    
T  20340536 tgggagtagctcggcatatagcattggtatcggaggaaaggtaggtctagc 20340586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 28152016 - 28151866
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| |||||||||||  ||| ||||||||| ||| ||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  28152016 gatggaaatcacatttgaggtcagaccggagcctgggaggtaacagatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagt 28151917  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  28151916 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 28151866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 41793416 - 41793559
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  41793416 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 41793515  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  41793516 aactcagcatataacatcggtatcggagggaaagtaggcctagc 41793559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 28585107 - 28584985
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  28585107 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 28585008  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  28585007 atcggagggaaagtaggcctagc 28584985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 10962796 - 10962674
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | || | ||| || || ||||| ||||||| ||| |||    
T  10962796 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagcaaagttggaagcaactcagcatataacatcggt 10962697  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  10962696 atcggagggaaagtaggcctagc 10962674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 127; Significance: 9e-66; HSPs: 33)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 16449985 - 16450135
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||||||| | |||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16449985 gatggaaatcacacttgaggtcagaacgaaacctgggaggcaaaggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 16450084  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  16450085 cgggagtaactcggcatatagcattggtatcggaggaaaggtaggtctagc 16450135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 16041479 - 16041329
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||| ||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16041479 gatggaaatcacactttaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 16041380  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||||||||||||||| | ||||||||||||||| || |||||||||||    
T  16041379 cgggagtaactcggcatacaacattggtatcggagggaaggtaggtctagc 16041329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 26484850 - 26484700
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  26484850 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagt 26484751  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  26484750 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 26484700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 2108992 - 2109142
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  2108992 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagt 2109091  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||| ||||| ||||||| |||||||||| ||||||| |||||||||||    
T  2109092 cgggagcaactcagcatatatcattggtatcagaggaaaggtaggtctagc 2109142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 2775515 - 2775365
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  2775515 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagt 2775416  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||  |||| |||||||||||||||||| ||||||| |||||||||||    
T  2775415 cgggagctactcagcatatagcattggtatcagaggaaaggtaggtctagc 2775365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 31088451 - 31088601
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  31088451 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 31088550  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  31088551 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 31088601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 39211010 - 39211160
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| ||||||| |||| ||||||||| ||||||||||||||||||||||||||||    
T  39211010 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaagcttcccctgtctgattgtgcagtgccctctgagaagtagagt 39211109  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  39211110 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 39211160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 45733616 - 45733466
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  45733616 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 45733517  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
       |||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  45733516 taagagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 45733466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 21 - 163
Target Start/End: Complemental strand, 18540947 - 18540805
Alignment:
Q  21 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 120  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |    
T  18540947 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagtcgggagca 18540848  T
Q  121 actcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||| |||||||||||||||||| |||||||||||||||||||    
T  18540847 actcagcatatagcattggtatcagaggaaaagtaggtctagc 18540805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 11424791 - 11424913
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||||||||||||||||||||| ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  11424791 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtgcaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 11424890  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  11424891 atcggagggaaagtaggtctagc 11424913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 5128141 - 5127998
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| |||||||||||||||||||| ||||| |||||||||||||| || ||||||||  | |||| ||| || ||     
T  5128141 atcacatttgagatcagacctgaaccttggaggcaacggattaggtgggggcttaccctgtctggttgtacaatgccctctatggagtaaagttggaagc 5128042  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||| | ||| ||||||||||||||||||||||||||    
T  5128041 aactcagcatacaacatcggtatcggaggaaaagtaggtctagc 5127998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 10916883 - 10917005
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  10916883 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 10916982  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  10916983 atcggagggaaagtaggtctagc 10917005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 16503395 - 16503517
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  16503395 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 16503494  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  16503495 atcggagggaaagtaggtctagc 16503517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 16518431 - 16518553
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  16518431 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 16518530  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  16518531 atcggagggaaagtaggtctagc 16518553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 5147334 - 5147477
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  5147334 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 5147433  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||||||||||||||||||    
T  5147434 aactcagcatataacatcggtatcggaggaaaagtaggtctagc 5147477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 2154701 - 2154579
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  2154701 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 2154602  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||| |||||||    
T  2154601 atcggagggaaagtatgtctagc 2154579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 16736454 - 16736597
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||| ||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  16736454 atcacatttgagatcagacctgaaccttggaggtaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 16736553  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  16736554 aactcagcatataacatcggtatcggagggaaagtaggcctagc 16736597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 16751508 - 16751651
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||| ||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  16751508 atcacatttgagatcagacctgaaccttggaggtaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 16751607  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  16751608 aactcagcatataacatcggtatcggagggaaagtaggcctagc 16751651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 17523681 - 17523538
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||| ||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  17523681 atcacatttgagatcagacctgaaccttggaggtaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 17523582  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  17523581 aactcagcatataacatcggtatcggagggaaagtaggcctagc 17523538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 17529534 - 17529677
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||| ||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  17529534 atcacatttgagatcagacctgaaccttggaggtaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 17529633  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  17529634 aactcagcatataacatcggtatcggagggaaagtaggcctagc 17529677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 4145138 - 4145260
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  4145138 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 4145237  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  4145238 atcggagggaaagtaggcctagc 4145260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 9618779 - 9618657
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  9618779 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 9618680  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  9618679 atcggagggaaagtaggcctagc 9618657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 26275109 - 26275231
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  26275109 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26275208  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  26275209 atcggagggaaagtaggcctagc 26275231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 26319884 - 26320006
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  26319884 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26319983  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  26319984 atcggagggaaagtaggcctagc 26320006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 45387471 - 45387349
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  45387471 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 45387372  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  45387371 atcggagggaaagtaggcctagc 45387349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 41 - 160
Target Start/End: Complemental strand, 3445434 - 3445315
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | |||||||    
T  3445434 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcatacaacattggt 3445335  T
Q  141 atcggaggaaaagtaggtct 160  Q
    || ||||||||||| |||||    
T  3445334 ataggaggaaaagttggtct 3445315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 26435406 - 26435263
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || ||     
T  26435406 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaaga 26435307  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  26435306 agttctgcatacaacattggtataggaggaaaagttggtctagc 26435263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 26669929 - 26670051
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| || |||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  26669929 gaaccttgggggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26670028  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  26670029 atcggagggaaagtaggcctagc 26670051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 41 - 162
Target Start/End: Original strand, 31564405 - 31564526
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  31564405 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 31564504  T
Q  141 atcggaggaaaagtaggtctag 162  Q
    || ||||||||||| |||||||    
T  31564505 ataggaggaaaagttggtctag 31564526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 41 - 160
Target Start/End: Original strand, 26537885 - 26538004
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || |  || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  26537885 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgcacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26537984  T
Q  141 atcggaggaaaagtaggtct 160  Q
    || ||||||||||| |||||    
T  26537985 ataggaggaaaagttggtct 26538004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 41 - 154
Target Start/End: Complemental strand, 11441700 - 11441587
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || || || | |||||||    
T  11441700 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcgtacaacattggt 11441601  T
Q  141 atcggaggaaaagt 154  Q
    || |||||||||||    
T  11441600 ataggaggaaaagt 11441587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 41 - 162
Target Start/End: Complemental strand, 31125048 - 31124927
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||| ||| || || |  || ||||| | |||||||    
T  31125048 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgtcctctctggagtaaagttggaagaagttctgcatacaacattggt 31124949  T
Q  141 atcggaggaaaagtaggtctag 162  Q
    || ||||||||||| |||||||    
T  31124948 ataggaggaaaagttggtctag 31124927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 21 - 163
Target Start/End: Complemental strand, 5159667 - 5159525
Alignment:
Q  21 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 120  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  5159667 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 5159568  T
Q  121 actcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
     ||| ||||| | ||||||||| ||||||||||| ||||||||    
T  5159567 gctctgcatacaacattggtataggaggaaaagttggtctagc 5159525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0558 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: scaffold0558
Description:

Target: scaffold0558; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 129 - 279
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||||||| ||||||||| ||||||||||| ||||||||||||||| |||||||||| ||||||||||||||||||||||||    
T  129 gatggaaatcacacttgaggtcagaacggaacctggaaggcaacggatcaggtggaggcttgccatgtctggttgagcagtgccctctgagaagtagagt 228  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  229 cgggagtaactcggcatatagcattggtatcggaggaaaggtaggtctagc 279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 24)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 15228040 - 15227890
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||||||| |||||||||||||||| |||| |||||||||||| |||||||||||||| |||||||||||||||||||||||    
T  15228040 gatggaaatcacacttgaggtcagaacggaacctgggaggcaatggatcaggtggaggcttaccctgtctggttgtacagtgccctctgagaagtagagt 15227941  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  15227940 cgggagtaactcggcatatagcattggtatcggaggaaaggtaggtctagc 15227890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 15285029 - 15285179
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||||||  ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15285029 gatggaaatcacacttgaggtcagaccggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 15285128  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||||||||||  |||||||||||||||||||||||| |||||||||||    
T  15285129 cgggagtaactcgaaatatagcattggtatcggaggaaaggtaggtctagc 15285179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 1900427 - 1900277
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||||||| | |||||| || ||||||||| |||||||||||| || |||||||||||||||||||||||||||||||||||    
T  1900427 gatggaaatcacacttgaggtcagaacgaaacctgagaagcaacggatcaggtggaggcttaccatgtctggttgtgcagtgccctctgagaagtagagt 1900328  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||||||||||||||| |||||||||||||||||||| |||||||||||    
T  1900327 cgggagtaactcggcatacagcattggtatcggaggaaaggtaggtctagc 1900277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 24460706 - 24460856
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  24460706 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 24460805  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  24460806 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 24460856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 13 - 160
Target Start/End: Original strand, 15391439 - 15391586
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||| ||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||| ||||||| | |||    
T  15391439 gatggaaatcgcacttgaggtcagaacggaacctgggaggcaacgggttaggtggaggcttcccctgcctggttgtgcagtgccctttgagaagcaaagt 15391538  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    |||||| |||||||| || |||||||||||||||||||| ||||||||    
T  15391539 cgggagcaactcggcgtacagcattggtatcggaggaaaggtaggtct 15391586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 14235626 - 14235776
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| ||||||||  ||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||| | ||||| |||||    
T  14235626 gatggaaatcacatttgaggtcgaaatggaacctgggaggcaaagggttaggtggaggcttgccctgtctggttgtacagtgccctttaagaagcagagt 14235725  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||| | ||||||||| | |||||||||| ||||||| |||||||||||    
T  14235726 cgggagcagctcggcatacaacattggtatcagaggaaaggtaggtctagc 14235776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 17014163 - 17014020
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| |||||||| ||   |||||||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| ||     
T  17014163 atcacatttgaggtcggacctgaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctttggagtaaagtcggaagc 17014064  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
T  17014063 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 17014020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 14763412 - 14763555
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  14763412 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 14763511  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  14763512 aactcagcatataacatcggtatcggagggaaagtaggtctagc 14763555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 24592443 - 24592565
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  24592443 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 24592542  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  24592543 atcggagggaaagtaggtctagc 24592565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 14098683 - 14098561
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | |||||||    
T  14098683 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcatacaacattggt 14098584  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    || ||||||||||||||||||||    
T  14098583 ataggaggaaaagtaggtctagc 14098561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 14665160 - 14665038
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  14665160 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagttggaagcaactcagcatacaacatcggt 14665061  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  14665060 atcggagggaaagtaggtctagc 14665038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 5006036 - 5005893
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||| ||||| ||||| || ||||||||  | |||| ||| || ||     
T  5006036 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccttgtctagttgtacaatgccctctctggagtaaagttggaagc 5005937  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  5005936 aactcagcatataacatcggtatcggagggaaagtaggcctagc 5005893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 6570016 - 6569873
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || ||     
T  6570016 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaaga 6569917  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |  || ||||| | ||||||||||||||| ||||||||||||||    
T  6569916 agttctgcatacaacattggtatcggagggaaagtaggtctagc 6569873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 27163446 - 27163568
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  27163446 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 27163545  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  27163546 atcggagggaaagtaggcctagc 27163568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 41 - 162
Target Start/End: Original strand, 18800742 - 18800863
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || || ||||| ||||| | |||||||    
T  18800742 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagcaactcagcatacaacattggt 18800841  T
Q  141 atcggaggaaaagtaggtctag 162  Q
    || ||||||||||| |||||||    
T  18800842 ataggaggaaaagttggtctag 18800863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 41 - 160
Target Start/End: Complemental strand, 30753896 - 30753777
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | |||||||    
T  30753896 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcatacaacattggt 30753797  T
Q  141 atcggaggaaaagtaggtct 160  Q
    || ||||||||||| |||||    
T  30753796 ataggaggaaaagttggtct 30753777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 31126647 - 31126769
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||| | |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || || | ||| ||||| | |||||||    
T  31126647 gaaccttggaggcaacgggtcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaagaagctctgcatacaacattggt 31126746  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    || |||||||||||||| |||||    
T  31126747 ataggaggaaaagtaggcctagc 31126769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 160
Target Start/End: Original strand, 33673906 - 33674046
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||| |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || ||     
T  33673906 atcacatttgagatcagacctgaaccttggaggcaacgggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagc 33674005  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    ||||| ||||| | ||||||||| ||||||||||| |||||    
T  33674006 aactcagcatacaacattggtataggaggaaaagttggtct 33674046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 20 - 162
Target Start/End: Original strand, 36344623 - 36344765
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  36344623 atcacatttgagatcagacctgaacctcggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 36344722  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctag 162  Q
    | ||| ||||| | ||| ||||| ||||||||||| |||||||    
T  36344723 agctctgcatacaacataggtataggaggaaaagttggtctag 36344765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 40105767 - 40105889
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || || |  || ||||||| ||| |||    
T  40105767 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagaagttcagcatataacatcggt 40105866  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  40105867 atcggagggaaagtaggcctagc 40105889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 21 - 163
Target Start/End: Complemental strand, 24112824 - 24112682
Alignment:
Q  21 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 120  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  24112824 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 24112725  T
Q  121 actcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
     ||| ||||| | ||||||||| ||||||||||| ||||||||    
T  24112724 gctctgcatacaacattggtataggaggaaaagttggtctagc 24112682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 21 - 163
Target Start/End: Original strand, 34189069 - 34189211
Alignment:
Q  21 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 120  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  34189069 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 34189168  T
Q  121 actcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
     ||| ||||| | ||||||||| ||||||||||| ||||||||    
T  34189169 gctctgcatacaacattggtataggaggaaaagttggtctagc 34189211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 20 - 162
Target Start/End: Complemental strand, 54833550 - 54833408
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||| | |||||| ||||||||||| || ||||| || ||||||||  | |||| ||| || ||     
T  54833550 atcacatttgagatcagacctgaaccttggaggcaacgggtcaggtgggggcttgccctgcctagttgtacaatgccctctttggagtaaagttggaaga 54833451  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctag 162  Q
    | ||| ||||| | ||| ||||| ||||||||||| |||||||    
T  54833450 agctctgcatacaacataggtataggaggaaaagttggtctag 54833408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 63 - 160
Target Start/End: Complemental strand, 39850758 - 39850661
Alignment:
Q  63 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  39850758 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 39850661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124 (Bit Score: 119; Significance: 5e-61; HSPs: 2)
Name: scaffold0124
Description:

Target: scaffold0124; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 20543 - 20393
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20543 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 20444  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||||||||| ||||| | |||||||||||| ||||| |||||||||||    
T  20443 cgggagtaactcagcatacaacattggtatcgggggaaaggtaggtctagc 20393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 41 - 88
Target Start/End: Complemental strand, 30579 - 30532
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgt 88  Q
    |||||| ||||||||||||| |||||| |||||||||||||| |||||    
T  30579 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgt 30532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 119; Significance: 5e-61; HSPs: 60)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 16626648 - 16626798
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  16626648 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctaagaagtagagt 16626747  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
     |||||||||||| |||||| |||||||||||||||||| |||||||||||    
T  16626748 agggagtaactcgacatatatcattggtatcggaggaaaggtaggtctagc 16626798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 18530504 - 18530354
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  18530504 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 18530405  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    | |||||||||| ||||| | |||||||||||||||||| |||||||||||    
T  18530404 caggagtaactcagcatacaacattggtatcggaggaaaggtaggtctagc 18530354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 4626060 - 4625910
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  4626060 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 4625961  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  4625960 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 4625910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 31034259 - 31034409
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| |||||||||||  ||||||| ||||| ||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  31034259 gatggaaatcacatttgaggtcagaccggaacctaggaggtaacggatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagt 31034358  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  31034359 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 31034409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 32292868 - 32292718
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||| ||| ||||||||| ||||||||||||||||||||||||||||    
T  32292868 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggagacttcccctgtctgattgtgcagtgccctctgagaagtagagt 32292769  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  32292768 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 32292718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 17993926 - 17994076
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| |||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  17993926 gatggaaatcacatttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 17994025  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  17994026 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 17994076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 5652503 - 5652353
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| |||| | ||||| ||||||||||||||||||||||||||||||| |||| ||||||||    
T  5652503 gatggaaatcacacttgaggtccgaacggaacttgggaggcgacgggtcaggtgaaggcttgccctgtctggttgtgcagtgccctttgaggagtagagt 5652404  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  5652403 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 5652353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 15892876 - 15892998
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    ||||||||||||||| |||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | |||||||    
T  15892876 gaacctgggaggcaaaggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacattggt 15892975  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  15892976 atcggagggaaagtaggtctagc 15892998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 8296060 - 8295938
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||||||||||||| ||| |||| | |||||||||||||||||||| || ||||||||| | |||| |||||| || ||||| ||||| | ||| |||    
T  8296060 gaacctgggaggcaacagatcaggtaggggcttgccctgtctggttgtacaatgccctctgtggagtaaagtcggaagcaactcagcatacaacatcggt 8295961  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  8295960 atcggagggaaagtaggtctagc 8295938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 8301437 - 8301559
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  8301437 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 8301536  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  8301537 atcggagggaaagtaggtctagc 8301559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 18330757 - 18330635
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | ||||  ||||| || ||||| ||||||| ||| |||    
T  18330757 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaggtcggaagcaactcagcatataacatcggt 18330658  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  18330657 atcggagggaaagtaggtctagc 18330635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 4721740 - 4721597
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| |||||||| ||   |||||| ||||||| ||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || ||     
T  4721740 atcacatttgaggtcggacctgaaccttggaggcagcggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagc 4721641  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  4721640 aactcagcatataacatcggtatcggagggaaagtaggtctagc 4721597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 22387727 - 22387870
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || ||     
T  22387727 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagc 22387826  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||| | ||||||||| ||||||||||| ||||||||    
T  22387827 aactctgcatacaacattggtataggaggaaaagtcggtctagc 22387870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 4796823 - 4796945
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  4796823 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 4796922  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  4796923 atcggagggaaagtaggtctagc 4796945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 15741264 - 15741386
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| |||||||||| || |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  15741264 gaaccttggaggcaacgaatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 15741363  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  15741364 atcggagggaaagtaggtctagc 15741386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 17985126 - 17985248
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || | ||| ||||| | |||||||    
T  17985126 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagctctgcatacaacattggt 17985225  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    || ||||||||||||||||||||    
T  17985226 ataggaggaaaagtaggtctagc 17985248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 18051350 - 18051228
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||||||||||| ||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  18051350 gaacctgggaggcagcggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagcaactcagcatacaacatcggt 18051251  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  18051250 atcggagggaaagtaggtctagc 18051228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 41 - 162
Target Start/End: Original strand, 6542632 - 6542753
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||||||||| |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  6542632 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtgcagtgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 6542731  T
Q  141 atcggaggaaaagtaggtctag 162  Q
    || ||||||||||| |||||||    
T  6542732 ataggaggaaaagttggtctag 6542753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 5609471 - 5609614
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  5609471 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 5609570  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  5609571 aactcagcatataacatcggtatcggagggaaagtaggcctagc 5609614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 6192425 - 6192282
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| |||||||| ||   |||||| ||||||| | ||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || ||     
T  6192425 atcacatttgaggtcggacctgaaccttggaggcagcagatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagc 6192326  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  6192325 aactcagcatataacatcggtatcggagggaaagtaggtctagc 6192282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 18277201 - 18277344
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||| ||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  18277201 atcacatttgagatcagacctgaaccttggaggcaactgatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 18277300  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  18277301 aactcagcatataacatcggtatcggagggaaagtaggtctagc 18277344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 18292502 - 18292645
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||| ||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  18292502 atcacatttgagatcagacctgaaccttggaggcaactgatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 18292601  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  18292602 aactcagcatataacatcggtatcggagggaaagtaggtctagc 18292645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 18307803 - 18307946
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||| ||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  18307803 atcacatttgagatcagacctgaaccttggaggcaactgatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 18307902  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  18307903 aactcagcatataacatcggtatcggagggaaagtaggtctagc 18307946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 28339411 - 28339268
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  28339411 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 28339312  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  28339311 aactcagcatataacatcggtatcggagggaaagtaggcctagc 28339268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 29148904 - 29149047
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  29148904 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctatggagtaaagttggaagc 29149003  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
T  29149004 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 29149047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 31964622 - 31964765
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  31964622 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 31964721  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  31964722 aactcagcatataacatcggtatcggagggaaagtaggcctagc 31964765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 50134220 - 50134363
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  50134220 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 50134319  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  50134320 aactcagcatataacatcggtatcggagggaaagtaggcctagc 50134363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 35880854 - 35880732
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||| ||||| |||||| |||||||||||| ||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  35880854 gaaccttggaggcagcggatcaggtgggggcttgccctgtttggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 35880755  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  35880754 atcggagggaaagtaggtctagc 35880732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 4417028 - 4416885
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| || ||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  4417028 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggtttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 4416929  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  4416928 aactcagcatataacatcggtatcggagggaaagtaggcctagc 4416885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 41 - 160
Target Start/End: Complemental strand, 5713315 - 5713196
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  5713315 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagcaactcagcatataacatcggt 5713216  T
Q  141 atcggaggaaaagtaggtct 160  Q
    |||||||| |||||||||||    
T  5713215 atcggagggaaagtaggtct 5713196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 41 - 160
Target Start/End: Complemental strand, 5724225 - 5724106
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  5724225 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagcaactcagcatataacatcggt 5724126  T
Q  141 atcggaggaaaagtaggtct 160  Q
    |||||||| |||||||||||    
T  5724125 atcggagggaaagtaggtct 5724106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 41 - 160
Target Start/End: Original strand, 5757252 - 5757371
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  5757252 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagcaactcagcatataacatcggt 5757351  T
Q  141 atcggaggaaaagtaggtct 160  Q
    |||||||| |||||||||||    
T  5757352 atcggagggaaagtaggtct 5757371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 41 - 160
Target Start/End: Original strand, 5768143 - 5768262
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  5768143 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagcaactcagcatataacatcggt 5768242  T
Q  141 atcggaggaaaagtaggtct 160  Q
    |||||||| |||||||||||    
T  5768243 atcggagggaaagtaggtct 5768262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 10396242 - 10396099
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||||||||| |||||  | |||| ||| || ||     
T  10396242 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtgcagtgtcctctctggagtaaagttggaaga 10396143  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    | ||| ||||| | ||| ||||||||||| ||||||||||||||    
T  10396142 agctctgcatacaacataggtatcggagggaaagtaggtctagc 10396099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 28116103 - 28116246
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| | |||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  28116103 atcacatttgagatcagacctgaaccttggaggcaacggatcaagtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 28116202  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    || || ||||||| ||| ||||||||||| ||||||||||||||    
T  28116203 aattcagcatataacatcggtatcggagggaaagtaggtctagc 28116246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 41 - 160
Target Start/End: Original strand, 36997247 - 36997366
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || | ||| ||||| | |||||||    
T  36997247 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagctctgcatacaacattggt 36997346  T
Q  141 atcggaggaaaagtaggtct 160  Q
    || ||||||||||| |||||    
T  36997347 ataggaggaaaagttggtct 36997366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 7996650 - 7996528
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  7996650 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 7996551  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  7996550 atcggagggaaagtaggcctagc 7996528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 10643158 - 10643036
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  10643158 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 10643059  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  10643058 atcggagggaaagtaggcctagc 10643036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 47023541 - 47023419
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  47023541 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 47023442  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  47023441 atcggagggaaagtaggcctagc 47023419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 7073321 - 7073178
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| ||| || ||||| || ||||| || || || ||||||||  | |||| ||| || ||     
T  7073321 atcacatttgagatcagacctgaaccttggaggcaacggatcaggcgggggcttaccttgtctagtcgtacaatgccctctttggagtaaagttggaagc 7073222  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||||||||||||||||||    
T  7073221 aactcagcatataacatcggtatcggaggaaaagtaggtctagc 7073178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 21674802 - 21674659
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||||||| || ||     
T  21674802 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctttggagtagagttggaaga 21674703  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  21674702 agttctgcatacaacattggtataggaggaaaagttggtctagc 21674659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 160
Target Start/End: Original strand, 11110498 - 11110638
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||||||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  11110498 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggaggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 11110597  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    |  || ||||| | ||||||||| ||||||||||| |||||    
T  11110598 agttctgcatacaacattggtataggaggaaaagttggtct 11110638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 4346836 - 4346979
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  4346836 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 4346935  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  4346936 agttctgcatacaacattggtataggaggaaaagttggtctagc 4346979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 41 - 162
Target Start/End: Complemental strand, 18242827 - 18242706
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||| ||| || || |  || ||||| | |||||||    
T  18242827 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgtcctctctggagtaaagttggaagaagttctgcatacaacattggt 18242728  T
Q  141 atcggaggaaaagtaggtctag 162  Q
    || ||||||||||| |||||||    
T  18242727 ataggaggaaaagttggtctag 18242706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 41 - 161
Target Start/End: Complemental strand, 5467073 - 5466953
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | ||| |||    
T  5467073 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaaggagttctgcatacaacataggt 5466974  T
Q  141 atcggaggaaaagtaggtcta 161  Q
    ||  |||||||||| ||||||    
T  5466973 ataagaggaaaagttggtcta 5466953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 20 - 160
Target Start/End: Complemental strand, 48466036 - 48465896
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  48466036 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctttggagtaaagttggaaga 48465937  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    |  || ||||| | ||||||||| ||||||||||| |||||    
T  48465936 agttctgcatacaacattggtataggaggaaaagttggtct 48465896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 22871005 - 22871148
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| ||||| || || || || ||||||||  | |||||||| || ||     
T  22871005 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgcctagtcgtacaatgccctctctggagtagagttggaaga 22871104  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  22871105 agttctgcatacaacattggtataggaggaaaagttggtctagc 22871148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 22886064 - 22886207
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| ||||| || || || || ||||||||  | |||||||| || ||     
T  22886064 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgcctagtcgtacaatgccctctctggagtagagttggaaga 22886163  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  22886164 agttctgcatacaacattggtataggaggaaaagttggtctagc 22886207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 28021384 - 28021241
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||| || |||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  28021384 atcacatttgagatcagacctgaaccttggaggtaatggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtatagttggaaga 28021285  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  28021284 agttctgcatacaacattggtataggaggaaaagttggtctagc 28021241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 41 - 100
Target Start/End: Complemental strand, 51782111 - 51782052
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctct 100  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||    
T  51782111 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctct 51782052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 21 - 163
Target Start/End: Complemental strand, 4893318 - 4893176
Alignment:
Q  21 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 120  Q
    |||||||| || ||||| |||||||| ||||| || || |  |||||||| |||||||| || || |||||||| |||||  | |||| ||| || || |    
T  4893318 tcacacttaagatcagagtggaaccttggaggtaaagggtccggtggaggtttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 4893219  T
Q  121 actcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
     ||| ||||| | ||||||||| ||||||||||| ||||||||    
T  4893218 gctctgcatacaacattggtataggaggaaaagttggtctagc 4893176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 41 - 154
Target Start/End: Complemental strand, 5013800 - 5013687
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || || |  || || || | |||||||    
T  5013800 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaagaagttccgcgtacaacattggt 5013701  T
Q  141 atcggaggaaaagt 154  Q
    || |||||||||||    
T  5013700 ataggaggaaaagt 5013687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 41 - 162
Target Start/End: Original strand, 5596527 - 5596648
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  5596527 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttctgcatacaacattggt 5596626  T
Q  141 atcggaggaaaagtaggtctag 162  Q
    || ||||| || || |||||||    
T  5596627 ataggagggaaggttggtctag 5596648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 63 - 160
Target Start/End: Original strand, 20577039 - 20577136
Alignment:
Q  63 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  20577039 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 20577136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 63 - 160
Target Start/End: Original strand, 29665162 - 29665259
Alignment:
Q  63 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  29665162 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 29665259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 63 - 162
Target Start/End: Complemental strand, 20066109 - 20066010
Alignment:
Q  63 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctag 162  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || | ||| ||||| | ||||||||| ||||||||||| |||||||    
T  20066109 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaagctctgcatacaacattggtataggaggaaaagttggtctag 20066010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 49 - 100
Target Start/End: Complemental strand, 51797192 - 51797141
Alignment:
Q  49 gaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctct 100  Q
    |||||||||||| |||||| |||||||||||||| ||||| || ||||||||    
T  51797192 gaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctct 51797141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 154
Target Start/End: Complemental strand, 8211847 - 8211713
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| ||||| || || || || ||||||||  | |||||||| || ||     
T  8211847 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgcctagtcgtacaatgccctctctggagtagagttggaaga 8211748  T
Q  120 aactcggcatatagcattggtatcggaggaaaagt 154  Q
    |  || ||||| | ||||||||| |||||||||||    
T  8211747 agttctgcatacaacattggtataggaggaaaagt 8211713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 18225279 - 18225157
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  18225279 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgacctctctggagtagagttggaagaagttctgcatacaacattggt 18225180  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    || ||||| || ||||| |||||    
T  18225179 ataggagggaaggtaggcctagc 18225157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 163
Target Start/End: Complemental strand, 32439262 - 32439120
Alignment:
Q  21 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 120  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  32439262 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 32439163  T
Q  121 actcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
      || ||||| | ||||||||| ||||||||||| ||||||||    
T  32439162 gttctgcatacaacattggtataggaggaaaagttggtctagc 32439120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0260 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: scaffold0260
Description:

Target: scaffold0260; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 2759 - 2909
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||||||| ||||||| ||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  2759 gatggaaatcacacttgaggtcagaacggaacctaggaggtaacggatcaggtggaggcttgccctgtctggttgtgtagtgccctctgagaagtagagt 2858  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
     ||||||| |||||||||||||||||||||||||||||| |||||||||||    
T  2859 tgggagtagctcggcatatagcattggtatcggaggaaaggtaggtctagc 2909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 49)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 22888634 - 22888484
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  22888634 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaaatagagt 22888535  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||||||||| ||||| | ||||||||||||||| || |||||||||||    
T  22888534 cgggagtaactcagcatacaacattggtatcggagggaaggtaggtctagc 22888484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 25199193 - 25199043
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||||||||| |||||| ||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25199193 gatggaaatcacacttgagatcagaacggaacctgggaggtaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 25199094  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||||||||||||||| | |||||||||||||| ||| |||||||||||    
T  25199093 cgggagtaactcggcatacaacattggtatcggagaaaaggtaggtctagc 25199043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 23892370 - 23892220
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| |||||||| ||  ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23892370 gatggaaatcacatttgaggtcggaccggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 23892271  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||| || ||||||||||| |  ||||||||||||||||| |||||||||||    
T  23892270 cggaagcaactcggcatacatgattggtatcggaggaaaggtaggtctagc 23892220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 13184646 - 13184796
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  13184646 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 13184745  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  13184746 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 13184796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 33877411 - 33877261
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  33877411 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 33877312  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  33877311 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 33877261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 11325958 - 11325808
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| |||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  11325958 gatggaaatcacatttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 11325859  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  11325858 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 11325808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 13440492 - 13440642
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  13440492 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 13440591  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| |  ||||||| |||||||||| ||||||| |||||||||||    
T  13440592 cgggagtaatttagcatataacattggtatcagaggaaaggtaggtctagc 13440642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 29889080 - 29889230
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||  ||||||||||  ||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  29889080 gatggaaatcacatatgaggtcagaccggaacctgggaggcaacggatcaggtggaggcttgccctgtctggtggtgcagtgccctctgagaagtagagt 29889179  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
     ||||||| ||| ||||| | |||||||||| ||||||| |||||||||||    
T  29889180 tgggagtagctcagcatacaacattggtatcagaggaaaggtaggtctagc 29889230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 23752455 - 23752598
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| |||||||| ||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| ||     
T  23752455 atcacatttgaggtcggacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagc 23752554  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  23752555 aactcagcatataacatcggtatcggagggaaagtaggtctagc 23752598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 11549490 - 11549368
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||||| ||| |||    
T  11549490 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatataacatcggt 11549391  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  11549390 atcggagggaaagtaggtctagc 11549368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 23718014 - 23718136
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||||| ||| |||    
T  23718014 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatataacatcggt 23718113  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  23718114 atcggagggaaagtaggtctagc 23718136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 30934769 - 30934647
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| || ||||| ||||||| ||| |||    
T  30934769 gaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagcaactcagcatataacatcggt 30934670  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  30934669 atcggagggaaagtaggtctagc 30934647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 24688183 - 24688305
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| |  || |||    
T  24688183 gaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaatatcggt 24688282  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  24688283 atcggagggaaagtaggtctagc 24688305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 24970154 - 24970032
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  24970154 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 24970055  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  24970054 atcggagggaaagtaggtctagc 24970032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 33777644 - 33777501
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| |||||||| ||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || ||     
T  33777644 atcacatttgaggtcggacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagc 33777545  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
T  33777544 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 33777501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 2511187 - 2511065
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  2511187 gaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 2511088  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  2511087 atcggagggaaagtaggcctagc 2511065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 8665501 - 8665623
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  8665501 gaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 8665600  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  8665601 atcggagggaaagtaggcctagc 8665623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 15758883 - 15759005
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  15758883 gaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 15758982  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  15758983 atcggagggaaagtaggcctagc 15759005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 6874462 - 6874319
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  6874462 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 6874363  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    | ||| ||||||| ||| ||||||||||| |||||||| |||||    
T  6874362 agctcagcatataacatcggtatcggagggaaagtaggcctagc 6874319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 9548548 - 9548691
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||||||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  9548548 atcacacttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 9548647  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    || || ||||||| ||| ||||||||||| ||||||||||||||    
T  9548648 aattcagcatataacatcggtatcggagggaaagtaggtctagc 9548691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 22999119 - 22999262
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||||||||| || ||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| ||| || ||     
T  22999119 atcacacttgagatcggacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagttggaagc 22999218  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
T  22999219 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 22999262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 26480528 - 26480406
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  26480528 gaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26480429  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  26480428 atcggagggaaagtaggcctagc 26480406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 20 - 162
Target Start/End: Original strand, 37671488 - 37671630
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || |||||||| |||||  | |||| ||| || ||     
T  37671488 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtgcagtgtcctctctggagtaaagttggaagc 37671587  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctag 162  Q
    ||||| ||||| | ||||||||| ||||||||||| |||||||    
T  37671588 aactcagcatacaacattggtataggaggaaaagttggtctag 37671630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 15658765 - 15658908
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  15658765 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 15658864  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||| ||||| ||||||||||||||    
T  15658865 aactcagcatataacatcggtattggagggaaagtaggtctagc 15658908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 41674866 - 41674723
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  41674866 atcacatttgagatcagatctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 41674767  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    || || ||||||| ||| ||||||||||| ||||||||||||||    
T  41674766 aattcagcatataacatcggtatcggagggaaagtaggtctagc 41674723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 5638046 - 5637924
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  5638046 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 5637947  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  5637946 atcggagggaaagtaggcctagc 5637924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 9317587 - 9317465
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  9317587 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 9317488  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  9317487 atcggagggaaagtaggcctagc 9317465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 12132291 - 12132169
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  12132291 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 12132192  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  12132191 atcggagggaaagtaggcctagc 12132169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 20 - 162
Target Start/End: Original strand, 18500735 - 18500877
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || ||     
T  18500735 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctttggagtaaagttggaagc 18500834  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctag 162  Q
    ||||| ||||||| ||| ||||| ||||||||||| |||||||    
T  18500835 aactcagcatataacatcggtataggaggaaaagttggtctag 18500877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 20 - 162
Target Start/End: Complemental strand, 28649392 - 28649250
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || ||     
T  28649392 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagc 28649293  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctag 162  Q
    ||||| ||||| | ||||||||| ||||||||||| |||||||    
T  28649292 aactcagcatacaacattggtataggaggaaaagttggtctag 28649250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 30152154 - 30152032
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  30152154 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 30152055  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  30152054 atcggagggaaagtaggcctagc 30152032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 30168605 - 30168483
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  30168605 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 30168506  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  30168505 atcggagggaaagtaggcctagc 30168483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 34616654 - 34616532
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || ||||| ||||| | |||||||    
T  34616654 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagcaactcagcatacaacattggt 34616555  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    || ||||||||||| ||||||||    
T  34616554 ataggaggaaaagttggtctagc 34616532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 41 - 154
Target Start/End: Complemental strand, 31431576 - 31431463
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||||||| || || ||||| ||||| | |||||||    
T  31431576 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtagagttggaagcaactcagcatacaacattggt 31431477  T
Q  141 atcggaggaaaagt 154  Q
    || |||||||||||    
T  31431476 ataggaggaaaagt 31431463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 41 - 160
Target Start/End: Original strand, 31826433 - 31826552
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | |||||||    
T  31826433 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcatacaacattggt 31826532  T
Q  141 atcggaggaaaagtaggtct 160  Q
    || ||||||||||| |||||    
T  31826533 ataggaggaaaagttggtct 31826552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 18375438 - 18375560
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || |  || ||||| | |||||||    
T  18375438 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagaagatctgcatacaacattggt 18375537  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    || ||||||||||||||||||||    
T  18375538 ataggaggaaaagtaggtctagc 18375560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 28959812 - 28959934
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  28959812 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttctgcatacaacattggt 28959911  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    || ||||||||||| ||||||||    
T  28959912 ataggaggaaaagttggtctagc 28959934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 20 - 162
Target Start/End: Original strand, 37770992 - 37771134
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || || |||||  | |||| ||| || ||     
T  37770992 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgacctctctggagtaaagttggaagc 37771091  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctag 162  Q
    ||||| ||||| | ||||||||| ||||||||||| |||||||    
T  37771092 aactcagcatacaacattggtataggaggaaaagttggtctag 37771134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 41 - 162
Target Start/End: Original strand, 37358669 - 37358790
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  37358669 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttccgcatacaacattggt 37358768  T
Q  141 atcggaggaaaagtaggtctag 162  Q
    || ||||||||||| |||||||    
T  37358769 ataggaggaaaagttggtctag 37358790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 32599477 - 32599620
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  32599477 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 32599576  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  32599577 agttctgcatacaacattggtataggaggaaaagttggtctagc 32599620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 41 - 162
Target Start/End: Complemental strand, 3789677 - 3789556
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || || |  || ||||| | |||||||    
T  3789677 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaagaagttctgcatacaacattggt 3789578  T
Q  141 atcggaggaaaagtaggtctag 162  Q
    || ||||||||||| |||||||    
T  3789577 ataggaggaaaagttggtctag 3789556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 41 - 162
Target Start/End: Complemental strand, 37755116 - 37754995
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||| ||||| || || || || |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  37755116 gaaccttggaggcaacggatcaggtggtggcttgccttgtctagtcgtacaatgacctctctggagtaaagttggaagcaactcagcatacaacattggt 37755017  T
Q  141 atcggaggaaaagtaggtctag 162  Q
    || ||||||||||| |||||||    
T  37755016 ataggaggaaaagttggtctag 37754995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 20 - 160
Target Start/End: Complemental strand, 43078409 - 43078269
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || || || ||||||||  | |||||||| || ||     
T  43078409 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtacaatgccctctctggagtagagttggaaga 43078310  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    |  || ||||| | ||||||||| ||||||||||| |||||    
T  43078309 agttctgcatacaacattggtataggaggaaaagttggtct 43078269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 21 - 163
Target Start/End: Complemental strand, 33292681 - 33292539
Alignment:
Q  21 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 120  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  33292681 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 33292582  T
Q  121 actcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
     ||| ||||| | ||||||||| ||||||||||| ||||||||    
T  33292581 gctctgcatacaacattggtataggaggaaaagttggtctagc 33292539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 33516492 - 33516370
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | ||||  || || || |  || ||||| | |||||||    
T  33516492 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtaaggttggaagaagttctgcatacaacattggt 33516393  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    || |||||||||||||| |||||    
T  33516392 ataggaggaaaagtaggcctagc 33516370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 63 - 160
Target Start/End: Complemental strand, 24681554 - 24681457
Alignment:
Q  63 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  24681554 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 24681457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 63 - 160
Target Start/End: Complemental strand, 24724081 - 24723984
Alignment:
Q  63 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  24724081 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 24723984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 63 - 160
Target Start/End: Original strand, 40473597 - 40473694
Alignment:
Q  63 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  40473597 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 40473694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 21 - 162
Target Start/End: Original strand, 13324835 - 13324976
Alignment:
Q  21 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 120  Q
    ||||| ||||| |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  13324835 tcacatttgagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 13324934  T
Q  121 actcggcatatagcattggtatcggaggaaaagtaggtctag 162  Q
      || ||||| | ||||||||| ||||||||||| |||||||    
T  13324935 gttctgcatacaacattggtataggaggaaaagttggtctag 13324976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 111; Significance: 3e-56; HSPs: 46)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 22456978 - 22457128
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |||||||||||||    
T  22456978 gatggaaatcacacttgaggtaagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccttatgagaagtagagt 22457077  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||||||||||||||| | |||||||||| ||||||| |||||||||||    
T  22457078 cgggagtaactcggcatacatcattggtatcagaggaaaggtaggtctagc 22457128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 22477317 - 22477467
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |||||||||||||    
T  22477317 gatggaaatcacacttgaggttagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccatatgagaagtagagt 22477416  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||||||||||||||| | |||||||||| ||||||| |||||||||||    
T  22477417 cgggagtaactcggcatacatcattggtatcagaggaaaggtaggtctagc 22477467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 27290414 - 27290564
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||||||| ||||| ||||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  27290414 gatggaaatcacacttgaggtcagaacggaacttgggaggtaacggatcaggtggaggcttgccctgtctggttgtgtagtgccctctgagaagtagagt 27290513  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||| ||||| ||||||| |||||||||| ||||||| |||||||||||    
T  27290514 cgggagcaactcagcatataacattggtatcagaggaaaggtaggtctagc 27290564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 8892354 - 8892504
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  8892354 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 8892453  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  8892454 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 8892504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 8903589 - 8903739
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  8903589 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 8903688  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  8903689 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 8903739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 13522117 - 13522267
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  13522117 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 13522216  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  13522217 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 13522267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 14143329 - 14143479
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||    
T  14143329 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgcgcagtgccctctgagaagtagagt 14143428  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  14143429 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 14143479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 26788096 - 26787946
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||    
T  26788096 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgcgcagtgccctctgagaagtagagt 26787997  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  26787996 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 26787946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 27196469 - 27196319
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||    
T  27196469 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgcgcagtgccctctgagaagtagagt 27196370  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  27196369 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 27196319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 27252771 - 27252921
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||    
T  27252771 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgcgcagtgccctctgagaagtagagt 27252870  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  27252871 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 27252921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 33374300 - 33374450
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  33374300 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 33374399  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  33374400 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 33374450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 28162809 - 28162659
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| | ||||||||||||||||||||||||||||||||||| |||||||||||||    
T  28162809 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaagtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 28162710  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  28162709 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 28162659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 15 - 162
Target Start/End: Complemental strand, 20160851 - 20160704
Alignment:
Q  15 tggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcg 114  Q
    |||| |||||||||||| || |||  |||||||||||| ||||||| ||||||||||||||| || ||||||||||| ||||||||| |||||| ||| |    
T  20160851 tggaaatcacacttgagatcggaacagaacctgggaggtaacggatcaggtggaggcttgccttgcctggttgtgcaatgccctctgtgaagtaaagttg 20160752  T
Q  115 ggagtaactcggcatatagcattggtatcggaggaaaagtaggtctag 162  Q
    |||||||||| ||||||| ||| |||||||||||||| ||||||||||    
T  20160751 ggagtaactcagcatataacatcggtatcggaggaaaggtaggtctag 20160704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 15 - 162
Target Start/End: Original strand, 22171980 - 22172127
Alignment:
Q  15 tggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcg 114  Q
    |||| |||||||||||| || |||  |||||||||||| ||||||| ||||||||||||||| || ||||||||||| ||||||||| |||||| ||| |    
T  22171980 tggaaatcacacttgagatcggaacagaacctgggaggtaacggatcaggtggaggcttgccttgcctggttgtgcaatgccctctgtgaagtaaagttg 22172079  T
Q  115 ggagtaactcggcatatagcattggtatcggaggaaaagtaggtctag 162  Q
    |||||||||| ||||||| ||| |||||||||||||| ||||||||||    
T  22172080 ggagtaactcagcatataacatcggtatcggaggaaaggtaggtctag 22172127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 22934924 - 22935074
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| |||||||| ||   |||||||||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||    
T  22934924 gatggaaatcacatttgaggtcggacctgaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagt 22935023  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||| || ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  22935024 cggaagcaactcagcatataacatcggtatcggagggaaagtaggtctagc 22935074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 23857369 - 23857519
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| |||||||| ||   |||||||||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||    
T  23857369 gatggaaatcacatttgaggtcggacctgaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagt 23857468  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||| || ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  23857469 cggaagcaactcagcatataacatcggtatcggagggaaagtaggtctagc 23857519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 13 - 160
Target Start/End: Original strand, 27272624 - 27272771
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| |||||||| ||   ||||||||||||| |||||| |||||| ||||| |||||||||||||| || ||||||||  | ||||||||    
T  27272624 gatggaaatcacatttgaggtcggacctgaacctgggaggcgacggatcaggtgggggcttaccctgtctggttgtacaatgccctctctggagtagagt 27272723  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    ||| || ||||| ||||||| ||| ||||||||||| |||||||||||    
T  27272724 cggaagcaactcagcatataacatcggtatcggagggaaagtaggtct 27272771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 26918525 - 26918382
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| ||     
T  26918525 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagc 26918426  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
T  26918425 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 26918382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 13299023 - 13299145
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  13299023 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 13299122  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  13299123 atcggagggaaagtaggtctagc 13299145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 24304690 - 24304812
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  24304690 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 24304789  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  24304790 atcggagggaaagtaggtctagc 24304812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 26989125 - 26989003
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| || ||||| ||||||| ||| |||    
T  26989125 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagcaactcagcatataacatcggt 26989026  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  26989025 atcggagggaaagtaggtctagc 26989003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 16749999 - 16749856
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  16749999 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctatggagtaaagttggaagc 16749900  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  16749899 aactcagcatataacatcggtatcggagggaaagtaggtctagc 16749856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 15424389 - 15424511
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  15424389 gaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 15424488  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  15424489 atcggagggaaagtaggtctagc 15424511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 24863841 - 24863719
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  24863841 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 24863742  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  24863741 atcggagggaaagtaggtctagc 24863719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 27000197 - 27000075
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  27000197 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 27000098  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  27000097 atcggagggaaagtaggtctagc 27000075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 41 - 162
Target Start/End: Complemental strand, 4525410 - 4525289
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| |||||||| || |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  4525410 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtgcaatgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 4525311  T
Q  141 atcggaggaaaagtaggtctag 162  Q
    || ||||||||||| |||||||    
T  4525310 ataggaggaaaagttggtctag 4525289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 29549620 - 29549477
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || ||     
T  29549620 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaaga 29549521  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    | ||| ||||| | ||||||||| ||||||||||| ||||||||    
T  29549520 agctctgcatacaacattggtataggaggaaaagttggtctagc 29549477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 41 - 162
Target Start/End: Complemental strand, 4773130 - 4773009
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  4773130 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 4773031  T
Q  141 atcggaggaaaagtaggtctag 162  Q
    || ||||||||||| |||||||    
T  4773030 ataggaggaaaagttggtctag 4773009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 41 - 160
Target Start/End: Complemental strand, 3696205 - 3696086
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || || ||||| ||||| | |||||||    
T  3696205 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagcaactcagcatacaacattggt 3696106  T
Q  141 atcggaggaaaagtaggtct 160  Q
    || ||||||||||| |||||    
T  3696105 ataggaggaaaagttggtct 3696086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 29573137 - 29573015
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| ||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  29573137 gaaccttggaggcaacggatcaggtgggggcttaccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 29573038  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    || ||||||||||| ||||||||    
T  29573037 ataggaggaaaagttggtctagc 29573015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 41 - 154
Target Start/End: Original strand, 4545847 - 4545960
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || ||||| ||||| | |||||||    
T  4545847 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagcaactcagcatacaacattggt 4545946  T
Q  141 atcggaggaaaagt 154  Q
    || |||||||||||    
T  4545947 ataggaggaaaagt 4545960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 41 - 154
Target Start/End: Original strand, 4724206 - 4724319
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||| ||||| || || || ||||||||  | |||||||| || || ||||| ||||| | |||||||    
T  4724206 gaaccttggaggcaacggatcaggtggtggcttgccttgtctagtcgtacaatgccctctctggagtagagttggaagcaactcagcatacaacattggt 4724305  T
Q  141 atcggaggaaaagt 154  Q
    || |||||||||||    
T  4724306 ataggaggaaaagt 4724319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 41 - 162
Target Start/End: Complemental strand, 4757888 - 4757767
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  4757888 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 4757789  T
Q  141 atcggaggaaaagtaggtctag 162  Q
    || ||||||||||| |||||||    
T  4757788 ataggaggaaaagttggtctag 4757767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 41 - 154
Target Start/End: Complemental strand, 28207578 - 28207465
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||| ||||| || || || ||||||||  | |||||||| || || ||||| ||||| | |||||||    
T  28207578 gaaccttggaggcaacggatcaggtggtggcttgccttgtctagtcgtacaatgccctctctggagtagagttggaagcaactcagcatacaacattggt 28207479  T
Q  141 atcggaggaaaagt 154  Q
    || |||||||||||    
T  28207478 ataggaggaaaagt 28207465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 160
Target Start/End: Complemental strand, 16674284 - 16674144
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  16674284 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 16674185  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    | ||| ||||| | ||||||||| ||||||||||| |||||    
T  16674184 agctctgcatacaacattggtataggaggaaaagttggtct 16674144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 160
Target Start/End: Original strand, 34463397 - 34463537
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| || ||||| || |||||||| |||||  | |||| ||| || ||     
T  34463397 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggctttccttgtctagtcgtgcagtgtcctctctggagtaaagttggaagc 34463496  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  34463497 aactcagcatataacatcggtataggaggaaaagttggtct 34463537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 20 - 162
Target Start/End: Complemental strand, 27007872 - 27007730
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  27007872 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 27007773  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctag 162  Q
    |  || ||||| | ||||||||| ||||||||||| |||||||    
T  27007772 agttctgcatacaacattggtataggaggaaaagttggtctag 27007730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 20 - 162
Target Start/End: Complemental strand, 27044532 - 27044390
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||| | |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  27044532 atcacatttgagatcagacctgaaccttggaggcaacgggtcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaaga 27044433  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctag 162  Q
    | ||| ||||| | ||| ||||| ||||||||||| |||||||    
T  27044432 agctctgcatacaacataggtataggaggaaaagttggtctag 27044390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 41 - 162
Target Start/End: Complemental strand, 27485253 - 27485132
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||| ||| || || |  || ||||| | |||||||    
T  27485253 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgtcctctctggagtaaagttggaagaagttctgcatacaacattggt 27485154  T
Q  141 atcggaggaaaagtaggtctag 162  Q
    || ||||||||||| |||||||    
T  27485153 ataggaggaaaagttggtctag 27485132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 26777687 - 26777809
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  |||||||| | ||| |||    
T  26777687 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttcggcatacaacatcggt 26777786  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    || ||||| || || ||||||||    
T  26777787 ataggagggaaggttggtctagc 26777809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 30558088 - 30558210
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | ||||  || || || |  || ||||| | |||||||    
T  30558088 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtaaggttggaagaagttctgcatacaacattggt 30558187  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    || |||||||||||||| |||||    
T  30558188 ataggaggaaaagtaggcctagc 30558210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 41 - 162
Target Start/End: Original strand, 26116482 - 26116603
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || || |||||  | |||| |||||| || |  || ||||| | ||| |||    
T  26116482 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgacctctctggagtaaagtcggaagaagttctgcatacaacatcggt 26116581  T
Q  141 atcggaggaaaagtaggtctag 162  Q
    || ||||||||||| |||||||    
T  26116582 ataggaggaaaagttggtctag 26116603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 41 - 162
Target Start/End: Original strand, 27360064 - 27360185
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | ||| |||    
T  27360064 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagaagttctgcatacaacatcggt 27360163  T
Q  141 atcggaggaaaagtaggtctag 162  Q
    || ||||||||||| |||||||    
T  27360164 ataggaggaaaagttggtctag 27360185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 41 - 162
Target Start/End: Original strand, 27450407 - 27450528
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | ||| |||    
T  27450407 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagaagttctgcatacaacatcggt 27450506  T
Q  141 atcggaggaaaagtaggtctag 162  Q
    || ||||||||||| |||||||    
T  27450507 ataggaggaaaagttggtctag 27450528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 41 - 162
Target Start/End: Complemental strand, 29501539 - 29501418
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  29501539 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttctgcatacaacattggt 29501440  T
Q  141 atcggaggaaaagtaggtctag 162  Q
    || ||||| || || |||||||    
T  29501439 ataggagggaaggttggtctag 29501418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 63 - 162
Target Start/End: Complemental strand, 17025379 - 17025280
Alignment:
Q  63 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctag 162  Q
    ||||||||||||||||| || || |||||||| |||||  | |||||||| || || |  || ||||| | ||||||||| ||||||||||| |||||||    
T  17025379 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtagagttggaagaagttctgcatacaacattggtataggaggaaaagttggtctag 17025280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 21)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 44563256 - 44563106
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  44563256 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 44563157  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  44563156 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 44563106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 9354777 - 9354627
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||| ||||||||    
T  9354777 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgaggagtagagt 9354678  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  9354677 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 9354627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 19659099 - 19659249
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| |||| | ||||||||||||||||||||||||||||||| ||||| |||||||||||||    
T  19659099 gatggaaatcacacttgaggtccgaacggaacttgggaggcgacgggtcaggtggaggcttgccctgtctggttgtgcagcgccctttgagaagtagagt 19659198  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  19659199 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 19659249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 13 - 160
Target Start/End: Original strand, 22080938 - 22081085
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||| ||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||| ||||||| | |||    
T  22080938 gatggaaatcgcacttgaggtcagaacggaacctgggaggcaacgggttaggtggaggctttccctgcctggttgtgcagtgccctttgagaagcaaagt 22081037  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    |||||| | |||||| || |||||||||||||||||||| ||||||||    
T  22081038 cgggagcagctcggcgtacagcattggtatcggaggaaaggtaggtct 22081085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 33244820 - 33244670
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||||||||||||||| ||| ||||| | |||||| |||| | ||||||||||||||||||||||||||||||| ||||| |||||||||||||    
T  33244820 gatggaaatcacacttgaggtccgaacggaacttaggaggcgacgggtcaggtggaggcttgccctgtctggttgtgcagcgccctttgagaagtagagt 33244721  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||| ||  |||||| |||||||||| ||||||| |||||||||||    
T  33244720 cgggagtaattcaacatataacattggtatcagaggaaaggtaggtctagc 33244670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 16283604 - 16283454
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| |||||| |||||||| ||   |||||||||||||||||||| |||||| |||||||||||||||||||| || |||||||| || |||| |||    
T  16283604 gatggaaatcacatttgaggtcggacctgaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctaaggagtaaagt 16283505  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||| || ||||| ||||| | ||| ||||||||||| || |||||||||||    
T  16283504 cggaagcaactcagcatacaacatcggtatcggagggaaggtaggtctagc 16283454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 16277681 - 16277559
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  16277681 gaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 16277582  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  16277581 atcggagggaaagtaggtctagc 16277559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 2137347 - 2137469
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  2137347 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 2137446  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  2137447 atcggagggaaagtaggtctagc 2137469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 19688225 - 19688103
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  19688225 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 19688126  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  19688125 atcggagggaaagtaggtctagc 19688103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 27608993 - 27609115
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  27608993 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 27609092  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  27609093 atcggagggaaagtaggtctagc 27609115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 31354672 - 31354529
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| |||||||| |||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  31354672 atcacatttgagatcagacctgaaccttggaggcaaaggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 31354573  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||||||||||| ||| ||||||||||| |||||||| |||||    
T  31354572 aactcggcatataacatcggtatcggagggaaagtaggcctagc 31354529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 14557751 - 14557629
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| ||| |  |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| |||||||    
T  14557751 gaaccttggaggcaacggatcaggcgagggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacattggt 14557652  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  14557651 atcggagggaaagtaggtctagc 14557629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 19208448 - 19208570
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  19208448 gaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 19208547  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  19208548 atcggagggaaagtaggcctagc 19208570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 31489838 - 31489960
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  31489838 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 31489937  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  31489938 atcggagggaaagtaggcctagc 31489960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 19674589 - 19674446
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| || ||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  19674589 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggtttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 19674490  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  19674489 aactcagcatataacatcggtatcggagggaaagtaggcctagc 19674446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 28362043 - 28362165
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  28362043 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 28362142  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  28362143 atcggagggaaagtaggcctagc 28362165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 41 - 162
Target Start/End: Original strand, 3329595 - 3329716
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  3329595 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 3329694  T
Q  141 atcggaggaaaagtaggtctag 162  Q
    || ||||||||||| |||||||    
T  3329695 ataggaggaaaagttggtctag 3329716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 18710734 - 18710591
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||||||||| |||||   |||||| ||||||| ||||| |||||  ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  18710734 atcacacttgagatcagacctgaaccttggaggcagcggatcaggtgagggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 18710635  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    ||||| ||||| | ||||||||| ||||||||||| ||||||||    
T  18710634 aactcagcatacaacattggtataggaggaaaagttggtctagc 18710591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 41 - 162
Target Start/End: Original strand, 12092812 - 12092933
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  12092812 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagaagttccgcatacaacattggt 12092911  T
Q  141 atcggaggaaaagtaggtctag 162  Q
    || ||||||||||| |||||||    
T  12092912 ataggaggaaaagttggtctag 12092933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 20 - 162
Target Start/End: Complemental strand, 19286610 - 19286468
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||| | |||||| ||||||||||| || ||||| || ||||||||  | |||| ||| || ||     
T  19286610 atcacatttgagatcagacctgaaccttggaggcaacgggtcaggtgggggcttgccctgcctagttgtacaatgccctctttggagtaaagttggaaga 19286511  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctag 162  Q
    | ||| ||||| | ||| ||||| ||||||||||| |||||||    
T  19286510 agctctgcatacaacataggtataggaggaaaagttggtctag 19286468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 40 - 162
Target Start/End: Complemental strand, 29829450 - 29829328
Alignment:
Q  40 ggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattgg 139  Q
    ||||||| ||||||||||||| |||||| ||||| ||||||||||| || || ||||||||  | |||| ||| || || |  || || || | ||||||    
T  29829450 ggaaccttggaggcaacggatcaggtgggggcttaccctgtctggtggtacaatgccctctctggagtaaagttggaagaagttctgcgtacaacattgg 29829351  T
Q  140 tatcggaggaaaagtaggtctag 162  Q
    ||| ||||||||||| |||||||    
T  29829350 tataggaggaaaagttggtctag 29829328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0109 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: scaffold0109
Description:

Target: scaffold0109; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 13 - 160
Target Start/End: Complemental strand, 21716 - 21569
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 112  Q
    |||||| ||| ||||||||||||||| ||||||||||||||||| | |||||||||||||||||||| |||||||||||||| ||| ||||||| | |||    
T  21716 gatggaaatcgcacttgaggtcagaacggaacctgggaggcaacaggttaggtggaggcttgccctgcctggttgtgcagtgtcctttgagaagcaaagt 21617  T
Q  113 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 160  Q
    |||||| | |||||||||||||||||||||||||||||| ||||||||    
T  21616 cgggagcagctcggcatatagcattggtatcggaggaaaggtaggtct 21569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0415 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: scaffold0415
Description:

Target: scaffold0415; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 13 - 98
Target Start/End: Original strand, 2018 - 2103
Alignment:
Q  13 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccct 98  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  2018 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccct 2103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0415; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 100
Target Start/End: Complemental strand, 6160 - 6080
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctct 100  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||    
T  6160 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctct 6080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: scaffold0143
Description:

Target: scaffold0143; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 27419 - 27297
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||||| ||| |||    
T  27419 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatataacatcggt 27320  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  27319 atcggagggaaagtaggtctagc 27297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089 (Bit Score: 59; Significance: 3e-25; HSPs: 3)
Name: scaffold0089
Description:

Target: scaffold0089; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 29890 - 29768
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  29890 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 29791  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  29790 atcggagggaaagtaggtctagc 29768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 40198 - 40320
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    ||||||||| |||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  40198 gaacctggggggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 40297  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  40298 atcggagggaaagtaggtctagc 40320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #3
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 47114 - 47236
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  47114 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagcaactcagcatacaacatcggt 47213  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| ||||||||||||||    
T  47214 atcggagggaaagtaggtctagc 47236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: scaffold0159
Description:

Target: scaffold0159; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 9195 - 9317
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  9195 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 9294  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  9295 atcggagggaaagtaggcctagc 9317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 41 - 163
Target Start/End: Complemental strand, 20142 - 20020
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  20142 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 20043  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  20042 atcggagggaaagtaggcctagc 20020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 258 - 381
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaact-cggcatatagcattgg 139  Q
    |||| |||||||||||||||  ||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||   ||||||| ||| ||    
T  258 gaacttgggaggcaacggatccggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactaaagcatataacatcgg 357  T
Q  140 tatcggaggaaaagtaggtctagc 163  Q
    ||||||||| ||||||||||||||    
T  358 tatcggagggaaagtaggtctagc 381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0350 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: scaffold0350
Description:

Target: scaffold0350; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 7368 - 7490
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  7368 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 7467  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    |||||||| |||||||| |||||    
T  7468 atcggagggaaagtaggcctagc 7490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0144 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0144
Description:

Target: scaffold0144; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 48 - 163
Target Start/End: Original strand, 26338 - 26453
Alignment:
Q  48 ggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggag 147  Q
    ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || || | ||| ||||| | ||||||||| ||||    
T  26338 ggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaagaagctctgcatacaacattggtataggag 26437  T
Q  148 gaaaagtaggtctagc 163  Q
    |||||||||| |||||    
T  26438 gaaaagtaggcctagc 26453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0237 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0237
Description:

Target: scaffold0237; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 15059 - 15181
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || |  || ||||| | |||||||    
T  15059 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagaagatctgcatacaacattggt 15158  T
Q  141 atcggaggaaaagtaggtctagc 163  Q
    || ||||||||||||||||||||    
T  15159 ataggaggaaaagtaggtctagc 15181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0038
Description:

Target: scaffold0038; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 41 - 154
Target Start/End: Complemental strand, 8076 - 7963
Alignment:
Q  41 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 140  Q
    |||||| ||||||||||||| |||||| |||||||| ||||| || || || ||||||||  | |||||||| || || ||||| ||||| | |||||||    
T  8076 gaaccttggaggcaacggatcaggtggtggcttgccttgtctagtcgtacaatgccctctctggagtagagttggaagcaactcagcatacaacattggt 7977  T
Q  141 atcggaggaaaagt 154  Q
    || |||||||||||    
T  7976 ataggaggaaaagt 7963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0336 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0336
Description:

Target: scaffold0336; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 9714 - 9571
Alignment:
Q  20 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 119  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||||||| || ||     
T  9714 atcacatttgagatcagatctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagtcgtacaatgccctctctggagtagagttggaaga 9615  T
Q  120 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 163  Q
    |  || ||||| | ||| ||||| ||||||||||| ||||||||    
T  9614 agttctgcatacaacataggtataggaggaaaagttggtctagc 9571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University