View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_679 (Length: 209)
Name: NF11453A_low_679
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_679 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 24 - 187
Target Start/End: Original strand, 35206363 - 35206526
Alignment:
| Q |
24 |
tctttctcctgtttttggacatgtcatgtttcctgctttaaaccatttttgaattgaggttctgttgtatgcttggccagtggaaacagttacaggatct |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35206363 |
tctttctcctgtttttggacatgtcatgtttcctgctttaaaccatttttgaattgaggttctgttgtatgtttggccagtggaaacagttacaggatct |
35206462 |
T |
|
| Q |
124 |
gtcattagttccagagaaatcggacaacggtaatcatccggtgttatgtagtttaacatctctg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35206463 |
gtcattagttccagagaaatcggacaacggtaatcatccggtgttatgtagtttaacatctctg |
35206526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University