View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_691 (Length: 205)
Name: NF11453A_low_691
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_691 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 186
Target Start/End: Complemental strand, 6359271 - 6359103
Alignment:
| Q |
18 |
aatatatttaataacgaaataataacagtagtagatagagagaattacaaggacgagcttaaattcaaaatgtctctcgtgtttgcatcaattgatttgc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6359271 |
aatatatttaataacgaaataataacagtagtaaatagagagaattacaaggacgagcttaaattcaaaacgtctctcgtgtttgcatcaattgatttgc |
6359172 |
T |
 |
| Q |
118 |
agtttctcaatccttttatatatggatatagcttcttgataatctgcatatactcaaggatctgacttc |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6359171 |
agtttctcaatccttttatatatggatatagcttcttgataatctgcatatactcaaggatctgacttc |
6359103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 113 - 186
Target Start/End: Original strand, 32857285 - 32857358
Alignment:
| Q |
113 |
tttgcagtttctcaatccttttatatatggatatagcttcttgataatctgcatatactcaaggatctgacttc |
186 |
Q |
| |
|
||||||||||||||||| |||||| ||||| |||||||| ||| ||||| |||||| |||||||| ||||||| |
|
|
| T |
32857285 |
tttgcagtttctcaatcattttatggatggaaatagcttcatgagaatctacatatagtcaaggatttgacttc |
32857358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University