View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11453A_low_697 (Length: 204)

Name: NF11453A_low_697
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11453A_low_697
NF11453A_low_697
[»] chr7 (1 HSPs)
chr7 (31-160)||(47358642-47358771)


Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 31 - 160
Target Start/End: Complemental strand, 47358771 - 47358642
Alignment:
31 attacatgatgagtaccctaaagttttgctattatagataaacataaacatgcatgcatgtggttcatcatcactgtccttttaggccatctctggtggg 130  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47358771 attacatgatgagtaccctaaagttttgctattatagataaacataaacatgcatgcatgtggttcatcatcactgtccttttaggccatctctggtggg 47358672  T
131 tctgcctgacttgtaaagctttgtacaaat 160  Q
    ||||||||||||||||||||||||| ||||    
47358671 tctgcctgacttgtaaagctttgtataaat 47358642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University