View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_704 (Length: 202)
Name: NF11453A_low_704
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_704 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 22 - 77
Target Start/End: Complemental strand, 32096650 - 32096595
Alignment:
| Q |
22 |
tttatgaccattttgaaattgggggtgtctcctttactgttaaaccagtatcagcc |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32096650 |
tttatgaccattttgaaattgggggtgtctcctttactgttaaaccagtatcagcc |
32096595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 141 - 184
Target Start/End: Complemental strand, 32096531 - 32096488
Alignment:
| Q |
141 |
agatatgaacaattttattctataatttttatgcatagtttcat |
184 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32096531 |
agatataaacaattttattctataatttttatgcatagtttcat |
32096488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University