View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_708 (Length: 202)
Name: NF11453A_low_708
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_708 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 20 - 135
Target Start/End: Complemental strand, 3446088 - 3445973
Alignment:
| Q |
20 |
ggtaggtgggtgaacaaattatgttttgaagcatcaaattgatttgacatcatgggaaactatagatattctttgctggctagacacagttttaatgtca |
119 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3446088 |
ggtaggtgggtgaacaaaatatgttttgaagcatcaaattgatttgacatcatgggaaactatagatattcttcgctggctagacacagttttaatgtca |
3445989 |
T |
|
| Q |
120 |
taatcacaagtgatca |
135 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3445988 |
taatcacaagtgatca |
3445973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University