View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_709 (Length: 202)
Name: NF11453A_low_709
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_709 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 10 - 187
Target Start/End: Complemental strand, 51212695 - 51212518
Alignment:
| Q |
10 |
catcatcagtacaacattgcaaaagtaggtccctcaaagaacattgtgaaacctgcagagtagtagtaattgagataacctcaagaaatcatacgatcac |
109 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51212695 |
catcatcagtacaacattgcaacagtaggtccctcaaagaacattgtgaaacctgcagagtagtagtaattgagataacctcaagaaatcatacgatcac |
51212596 |
T |
|
| Q |
110 |
tggtttaaatatcctcaagcagatatcaatacgttaaacagcataggaaagttcaggaaatgcagattagatgtccat |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51212595 |
tggtttaaatatcctcaagcagatatcaatacattaaacagcataggaaagttcaggaaatgcagattagatgtccat |
51212518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University