View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_74 (Length: 409)
Name: NF11453A_low_74
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_74 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 366 - 408
Target Start/End: Original strand, 12355218 - 12355260
Alignment:
| Q |
366 |
caataaggtagacgacatagaaccacctattttctaccagatt |
408 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12355218 |
caataaggtagacggcatagaaccacctattttctaccagatt |
12355260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University