View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11453A_low_74 (Length: 409)

Name: NF11453A_low_74
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11453A_low_74
NF11453A_low_74
[»] chr5 (1 HSPs)
chr5 (366-408)||(12355218-12355260)


Alignment Details
Target: chr5 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 366 - 408
Target Start/End: Original strand, 12355218 - 12355260
Alignment:
366 caataaggtagacgacatagaaccacctattttctaccagatt 408  Q
    |||||||||||||| ||||||||||||||||||||||||||||    
12355218 caataaggtagacggcatagaaccacctattttctaccagatt 12355260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University