View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_77 (Length: 404)
Name: NF11453A_low_77
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_77 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 13308273 - 13308016
Alignment:
| Q |
1 |
aagctgtcttagtgtttctcagtttcgtttcaatgacttccatttctctgacatttgtttcaaacttttggtttcaannnnnnngccatttgattgataa |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13308273 |
aagctgtcttagtttttctcagtttcgtttcaatgacttccatttctctgacatttgtttcaaacttttggtttcaatttttttgccatttgattgataa |
13308174 |
T |
|
| Q |
101 |
attttgattgtgaactcctcttattttggatttcttctaggtggaccttcactctggttacaatttattttggggtatggctcttgattctccttggaag |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13308173 |
attttgattgtgaactc-tcttattttggatttcttctaggtggaccttcactctggttacaatttattttggggtatggctcttaattctccttggaaa |
13308075 |
T |
|
| Q |
201 |
cattgccttttatcgaaccaatcctattgatatatcttcttttgcgactttgtgatgtt |
259 |
Q |
| |
|
| ||||||| ||||||||||| ||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
13308074 |
ccttgccttggatcgaaccaatgctattcatatatcttcttttgtgactttgtgatgtt |
13308016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 331 - 398
Target Start/End: Complemental strand, 13308010 - 13307943
Alignment:
| Q |
331 |
atttatgtctcacgattcgaactttctttttgtagtgtgcatctgtgctatcagtgtatgggtgttac |
398 |
Q |
| |
|
||||||||||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13308010 |
atttatgtctcacaatttgaactttcttgttgtagtgtgcatctgtgctatcagtgtatgggtgttac |
13307943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University