View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_84 (Length: 398)
Name: NF11453A_low_84
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_84 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 282; Significance: 1e-158; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 6 - 307
Target Start/End: Complemental strand, 5012345 - 5012044
Alignment:
| Q |
6 |
atccttttcatctgcaaaattacttccaggagttacgttccctccttgttgatgtgttgcatctaacacatgcctcgcggggtattgagaaggtgttcca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5012345 |
atccttttcatctgcaaaattacttccaggagttacgttccctccttgttgatgtgttgcatctaacacatgcctcgcggggtattgagaaggtgttcca |
5012246 |
T |
 |
| Q |
106 |
gcagtattcccaatatatctaacataacgaactggtatttctttgtgatctacctttttgaggataactttttcaaagatgggtgatttactctcaaact |
205 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5012245 |
gcagtattcccaatatatctagcataacgaactggtatttctttgtgatctacctttttgaggataactttttcaaagatgggtgatttactctcaaact |
5012146 |
T |
 |
| Q |
206 |
gaggcttaatcggtgcaggttttttgccgtgagctagcggttgagacacccataatgcattgatcggtgatagcttagcaggcctacctctctttcgggg |
305 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
5012145 |
gagtcttaatcggtgcaggttttttgccgtgagctagcggttgagacacccataatgaattgatcggtgatagcttagcaggcctccctctctttcgtgg |
5012046 |
T |
 |
| Q |
306 |
tt |
307 |
Q |
| |
|
|| |
|
|
| T |
5012045 |
tt |
5012044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 358 - 387
Target Start/End: Complemental strand, 5012023 - 5011994
Alignment:
| Q |
358 |
ttgagtgacgaaacttcttgttcaagtata |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5012023 |
ttgagtgacgaaacttcttgttcaagtata |
5011994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University