View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_90 (Length: 392)
Name: NF11453A_low_90
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_90 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 22 - 230
Target Start/End: Complemental strand, 33818589 - 33818381
Alignment:
| Q |
22 |
agacggcacgaggagattctaggaaaattaaagaggggtctacatgttttccattcgcagaaccatttgtcaatcataattataatcgattgagagacga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33818589 |
agacggcacgaggagattctaggaaaattaaagaggggtctacatgttttccattcgcagaaccatttgtcaatcataattataatcgattgagagacga |
33818490 |
T |
 |
| Q |
122 |
ccttgacgatgaagggcaaattaatcttatctcttgatgagttacatgatgtagcatgttgatcacactcatttcctgcgtagtcttggtttcatattct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |||||||||| || |
|
|
| T |
33818489 |
ccttgacgatgaagggcaaattaatcttatctcttgatgagttacaagatgtagcatgttgatcacactcatttccttcgtagtctaggtttcatatgct |
33818390 |
T |
 |
| Q |
222 |
acacatctt |
230 |
Q |
| |
|
||| ||||| |
|
|
| T |
33818389 |
acaaatctt |
33818381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University