View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453_high_14 (Length: 476)
Name: NF11453_high_14
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-131; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 44 - 352
Target Start/End: Original strand, 51724757 - 51725066
Alignment:
| Q |
44 |
agtttaatatttgtgaaatgatatatatttggttcatataaattcgtgannnnnnnnnnnnnnnnat-accgaaaaaggcacatatacagcaaaaatcca |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | || ||||||||||||| ||||||||||||||| |
|
|
| T |
51724757 |
agtttaatatttgtgaaatgatatatatttggttcatataaattcgtgattttttatttttcttttttactgaaaaaggcacatctacagcaaaaatcca |
51724856 |
T |
 |
| Q |
143 |
cctagaaaattttgcctaatcgataatattaagatagcatatgaaatttgacctaacttgtaaaattttctttgtatacttgaggtgcaatgatgaagat |
242 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51724857 |
cctagaaaattttgcctgatcgataatattaagatagcatatgaaatttgacctaacttgtaaaattttctttgtatacttgaggtgcaatgatgaagat |
51724956 |
T |
 |
| Q |
243 |
catatctagtgcacctctgctatgacataaataaaatcctagttgccgactaggcatcctgtatctccatttcattggttccaacctcagaggcaatatc |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51724957 |
catatctagtgcacctctgctatgacataaataaaatcctagttgccgactaggcatcctgtatctccatttcattggttccaacctcagaggcaatatc |
51725056 |
T |
 |
| Q |
343 |
tcacgatcaa |
352 |
Q |
| |
|
|||||||||| |
|
|
| T |
51725057 |
tcacgatcaa |
51725066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 425 - 462
Target Start/End: Original strand, 51725141 - 51725179
Alignment:
| Q |
425 |
gtcagcttaaccttt-acactttgatgcatgtgcccctt |
462 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51725141 |
gtcagcttaaccttttacactttgatgcatgtgcccctt |
51725179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University