View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453_high_22 (Length: 419)
Name: NF11453_high_22
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 328; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 18 - 345
Target Start/End: Original strand, 4196299 - 4196626
Alignment:
| Q |
18 |
gtaatttgaggaagatttcacctttggttaaggatctgtgcaagaaacataatcttccttacaattgtgtgtctttctggaaggctaatgtgcttactat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4196299 |
gtaatttgaggaagatttcacctttggttaaggatctgtgcaagaaacataatcttccttacaattgtgtgtctttctggaaggctaatgtgcttactat |
4196398 |
T |
 |
| Q |
118 |
tcagactttgaggaatgcggctttgcaggcgagggatcttactaaaccagttcctagaaatttagtttgggaagctgttaatactcatggatgaatgttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4196399 |
tcagactttgaggaatgcggctttgcaggcgagggatcttactaaaccagttcctagaaatttagtttgggaagctgttaatactcatggatgaatgttc |
4196498 |
T |
 |
| Q |
218 |
caattgagtgaagcttcgtaagaataataactgttttgcaaattgcttagatgcttagattcgattgctaattgtcttagctgtttgcatgctgttgata |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4196499 |
caattgagtgaagcttcgtaagaataataactgttttgcaaattgcttagatgcttagattcgattgctaattgtcttagctgtttgcatgctgttgata |
4196598 |
T |
 |
| Q |
318 |
ctgataagaaaagaactattgatacttg |
345 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
4196599 |
ctgataagaaaagaactattgatacttg |
4196626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 116 - 192
Target Start/End: Original strand, 4187218 - 4187294
Alignment:
| Q |
116 |
attcagactttgaggaatgcggctttgcaggcgagggatcttactaaaccagttcctagaaatttagtttgggaagc |
192 |
Q |
| |
|
|||||||| ||||||||||| |||||||| || |||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
4187218 |
attcagacgttgaggaatgctgctttgcaagctcgggatcttactaaaccgattccgagaaatttagtttgggaagc |
4187294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University