View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453_high_33 (Length: 363)
Name: NF11453_high_33
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453_high_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 33818587 - 33818381
Alignment:
| Q |
1 |
acggcacgaggagattctaggaaaattaaagaggggtctacatgttttccattcgcagaaccatttgtcaatcataattataatcgattgagagacgacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33818587 |
acggcacgaggagattctaggaaaattaaagaggggtctacatgttttccattcgcagaaccatttgtcaatcataattataatcgattgagagacgacc |
33818488 |
T |
 |
| Q |
101 |
ttgacgatgaagggcaaattaatcttatctcttgatgagttacatgatgtagcatgttgatcacactcatttcctgcgtagtcttggtttcatattctac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |||||||||| |||| |
|
|
| T |
33818487 |
ttgacgatgaagggcaaattaatcttatctcttgatgagttacaagatgtagcatgttgatcacactcatttccttcgtagtctaggtttcatatgctac |
33818388 |
T |
 |
| Q |
201 |
acatctt |
207 |
Q |
| |
|
| ||||| |
|
|
| T |
33818387 |
aaatctt |
33818381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University