View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453_high_42 (Length: 337)
Name: NF11453_high_42
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453_high_42 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 1e-53; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 17 - 138
Target Start/End: Complemental strand, 9921017 - 9920895
Alignment:
| Q |
17 |
aatggctactctatcaaattctatcgctatgccgataaatcaacagacccattttctctcaggtgatgatcacttcaatctcagtggcactcattttatt |
116 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9921017 |
aatggccactctatcaaattctatcgctatgccgataaatcaacaaacccattttctctcaggtgatgatcacttcaatctcagtggcactcattttatt |
9920918 |
T |
|
| Q |
117 |
ggtt-ttttaattgtaaattcaa |
138 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
9920917 |
ggtttttttaattgtaaattcaa |
9920895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 178 - 230
Target Start/End: Complemental strand, 9920854 - 9920802
Alignment:
| Q |
178 |
gttagtgagggaaatgtttgatctatattctcttatgttaactagtaaaagga |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9920854 |
gttagtgagggaaatgtttgatctatattctcttatgttaactagtaaaagga |
9920802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 291 - 329
Target Start/End: Complemental strand, 9920738 - 9920700
Alignment:
| Q |
291 |
taaattgatggtaattcaatattgggattgatctctgct |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9920738 |
taaattgatggtaattcaatattgggattgatctttgct |
9920700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University