View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453_high_64 (Length: 269)
Name: NF11453_high_64
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453_high_64 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 3651442 - 3651210
Alignment:
| Q |
18 |
aattagtaggtgaaatagagctcatatggaatttaattagtcttaagaaaaatgtttaacatttctactttgtggcattgttgtttcttctagaacccct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3651442 |
aattagtaggtgaaatagagctcatatgaaatttaattagtcttaagaaaaatgtttaacatttcttctttgtggcattgttgtttcttctagaacccct |
3651343 |
T |
|
| Q |
118 |
aaccatatcaaaatcgattgccacgttttctgttttaagatacacatgcaactctttcaattcatttcaattactagaattaattagcttcatgatattc |
217 |
Q |
| |
|
|| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || |||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
3651342 |
aaacatatcaaaatcgattgccac-ttttctgttttaagatacacatgcaactctttcactttattttcattactataattaattagcttcatgatattc |
3651244 |
T |
|
| Q |
218 |
ttaccaaccccattgacgtgtttgacatccactt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
3651243 |
ttaccaaccccattgacgtttttgacatccactt |
3651210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University