View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453_high_70 (Length: 249)
Name: NF11453_high_70
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453_high_70 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 4 - 233
Target Start/End: Original strand, 31910454 - 31910682
Alignment:
| Q |
4 |
tatgaaatacgaaaacaacttttatctcattttgtaacacaatttagactataaatagtcagttaattgcaaccaaaattgtgagaaaactgaagggaat |
103 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31910454 |
tatgaaatacgagaacaacttttatctcattttataacacaatttagactatcaatagtcagttaattgcaaccaaaattgtgagaaaactgaagggaat |
31910553 |
T |
 |
| Q |
104 |
taagtcttcttctcaaagtaaccaaaatcacttaaaaatgacatgtatattaaaagttatacggaaaatactatcaagatgtccaaaatacgagttgaaa |
203 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||| ||| || |
|
|
| T |
31910554 |
taagtcttcttctcaatgtaactaaaatcacttaaaaatggcatgtatattaaaagttatacgg-aaatactatcaagatatccaaaatacgatttgcaa |
31910652 |
T |
 |
| Q |
204 |
tattttatataaatcaataaatttagcatg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31910653 |
tattttatataaatcaataaatttagcatg |
31910682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University