View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453_high_72 (Length: 247)
Name: NF11453_high_72
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453_high_72 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 5 - 168
Target Start/End: Original strand, 44036110 - 44036270
Alignment:
| Q |
5 |
ggtagcatggattctttggaaatgccaccaaaacctgtaatgttttctcctccaagatcaataccagaattttctacttcatcaaaatcattggaaagct |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44036110 |
ggtagcatggattctttggaaatgccaccaaaacctgtaatgttttctcctccaagatcaataccagaattttctacttcatcaaaatcattggaaagct |
44036209 |
T |
|
| Q |
105 |
tctctagctaactaatggaaattatgatgtaagagttggttgtgttttttcaagacaccaaggt |
168 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44036210 |
tctctagctaactaatggaa---atgatgtaagagttggttgtgttttttcaagacaccaaggt |
44036270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 166 - 245
Target Start/End: Original strand, 44036315 - 44036390
Alignment:
| Q |
166 |
ggttacatacacatcatgtatatgagtatatgtatgtatgttttcagttaatctcagtaactgcttctgtctctgctcct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
44036315 |
ggttacatacacatcatgtatatgagtatatg----tatgttttcagttaatctcagtaactgcttctgcctctgttcct |
44036390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University