View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453_high_76 (Length: 242)
Name: NF11453_high_76
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453_high_76 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 30003151 - 30002927
Alignment:
| Q |
18 |
tatctttggtttatatgtaggcattaaaataaattgtaaataaaaagagttctccaactaatattgagtgctttccactcatcttccttttaccaaacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30003151 |
tatctttggtttatatgtaggcattaaaataaattgtaaataaagagagttctccaaccaatattgagtgctttccactcatcttccttttaccaaacaa |
30003052 |
T |
 |
| Q |
118 |
atggttttataattttcattggattttagagcattgaaccaactccctatagggaaacaatcaatattataatgagaggaagcaactaatcaatcatata |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30003051 |
atggttttataattttcattggattttagagcattgaaccaactccctatagggaaacaatcaatattatattgagaggaagcaactaatcaatcatata |
30002952 |
T |
 |
| Q |
218 |
tatgtatcccacatgtcactgcctt |
242 |
Q |
| |
|
|||| |||||||||||||||||||| |
|
|
| T |
30002951 |
tatgcatcccacatgtcactgcctt |
30002927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University