View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11453_high_77 (Length: 242)

Name: NF11453_high_77
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11453_high_77
NF11453_high_77
[»] chr7 (2 HSPs)
chr7 (18-112)||(7323128-7323222)
chr7 (143-213)||(7323721-7323791)


Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 18 - 112
Target Start/End: Original strand, 7323128 - 7323222
Alignment:
18 ccatgtatgacgaactatggtggtgtcaaaggatgtcctttattactttctcccctacacacatgcacgatacccattatttccaacattgaaaa 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7323128 ccatgtatgacgaactatggtggtgtcaaaggatgtcctttattactttctcccctacacacatgcacgatacccattatttccaacattgaaaa 7323222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 143 - 213
Target Start/End: Original strand, 7323721 - 7323791
Alignment:
143 acattttccaaaaattgctcgtactttgttattactgccattacacattaattcaattggaagattccaat 213  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
7323721 acattttccaaaaattgctcgtactttgttatcactgccattacacattaattcaattggaagattccaat 7323791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University