View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453_high_94 (Length: 213)
Name: NF11453_high_94
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453_high_94 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 15 - 192
Target Start/End: Original strand, 31457782 - 31457962
Alignment:
| Q |
15 |
atgaagaccactaaaatagccttgagggttgttttcaaatgcaccacgagatatgtatgatccaccacctcccggtgctttcattgaatccccaccacca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31457782 |
atgaagaccactaaaatagccttgagggttgttttcaaatgcaccacgagatatgtatgatccaccacctccaggtgctttcattgaatccccaccacca |
31457881 |
T |
 |
| Q |
115 |
ctgccaccggtggaccctttgcttcc---accgccgcctccttttgcgccacctccaccaccaccttttgaaccaccgcta |
192 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31457882 |
ctgccaccggtggaccctttgcttccggtaccaccgcctccttttgcgccacctccaccaccaccttttgcaccaccgcta |
31457962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 15 - 176
Target Start/End: Original strand, 49085731 - 49085892
Alignment:
| Q |
15 |
atgaagaccactaaaatagccttgagggttgttttcaaatgcaccacgagatatgtatgatccaccacctcccggtgctttcattgaatccccaccacca |
114 |
Q |
| |
|
||||||||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49085731 |
atgaagaccaccaaaatagccttgtgggttgctttcaaatgcaccacgagatatgtatgatccaccacctcccggtgctttcattgaatctccaccacca |
49085830 |
T |
 |
| Q |
115 |
ctgccaccggtggaccctttgcttccaccgccgcctccttttgcgccacctccaccaccacc |
176 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
49085831 |
ctgccaccggtggaccctttgcttccaccaccgcctccttttgtgccacctcctccaccacc |
49085892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University