View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453_high_96 (Length: 211)
Name: NF11453_high_96
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453_high_96 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 12 - 195
Target Start/End: Complemental strand, 53660546 - 53660363
Alignment:
| Q |
12 |
gcagagaccggaacatatcggtggatggctccagaggtctgtgtatatatataagcattgccatagggttggttacttctaaatttttaaatgtataacc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
53660546 |
gcagagaccggaacatatcggtggatggctccagaggtctgtgtatatatataagcattgccatagggttggttacttctaaattttaaaatgtataacc |
53660447 |
T |
 |
| Q |
112 |
tacaggtttggatgaggaagtttaagacgaacctagacaagttggaatgagaatgacggcttttatgctgaaaattgaataatt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53660446 |
tacaggtttggatgaggaagtttaagacgaacctagactagttggaatgagaatgacggcttttatgctgaaaattgaataatt |
53660363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University