View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11453_high_98 (Length: 208)

Name: NF11453_high_98
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11453_high_98
NF11453_high_98
[»] chr6 (2 HSPs)
chr6 (1-123)||(7345297-7345419)
chr6 (115-189)||(7345038-7345112)


Alignment Details
Target: chr6 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 7345419 - 7345297
Alignment:
1 tcttcgtagtaatctcttgtgacatgaacaattgtctttttattttacgttaaccctcctatttgcagaaaaggaccttgataagttggaattcgaccgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| || |  |||    
7345419 tcttcgtagtaatctcttgtgacatgaacaattgtctttttattttacgttaaccctcctatttgcagagaaggaccttgataatttggagtttggtcgt 7345320  T
101 ggatcaaaatagtccgataaaaa 123  Q
    |||||||||||||||||||||||    
7345319 ggatcaaaatagtccgataaaaa 7345297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 115 - 189
Target Start/End: Complemental strand, 7345112 - 7345038
Alignment:
115 cgataaaaaatgataatctgatcaaaaattgtttcgtctaagaatcaaacctactttctttcaatcaattcgtct 189  Q
    |||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| ||||||||    
7345112 cgataaaaaatgataatctgatcaaagattgtttcgtctaggaatcaaacctactttctttcaatcgattcgtct 7345038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University