View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11453_low_100 (Length: 211)

Name: NF11453_low_100
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11453_low_100
NF11453_low_100
[»] chr3 (1 HSPs)
chr3 (12-195)||(53660363-53660546)


Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 12 - 195
Target Start/End: Complemental strand, 53660546 - 53660363
Alignment:
12 gcagagaccggaacatatcggtggatggctccagaggtctgtgtatatatataagcattgccatagggttggttacttctaaatttttaaatgtataacc 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
53660546 gcagagaccggaacatatcggtggatggctccagaggtctgtgtatatatataagcattgccatagggttggttacttctaaattttaaaatgtataacc 53660447  T
112 tacaggtttggatgaggaagtttaagacgaacctagacaagttggaatgagaatgacggcttttatgctgaaaattgaataatt 195  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
53660446 tacaggtttggatgaggaagtttaagacgaacctagactagttggaatgagaatgacggcttttatgctgaaaattgaataatt 53660363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University