View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11453_low_33 (Length: 371)

Name: NF11453_low_33
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11453_low_33
NF11453_low_33
[»] chr1 (2 HSPs)
chr1 (23-187)||(47340273-47340435)
chr1 (253-354)||(47340173-47340274)


Alignment Details
Target: chr1 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 23 - 187
Target Start/End: Complemental strand, 47340435 - 47340273
Alignment:
23 aatgttatgactttattgaaaataaatagaataaaattaaacatattctaatcggttttggagtatctattagaatagctccaatactcgtcacagcgat 122  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
47340435 aatgttatgactttattgaaaataa-tagaataaaattaaacatattctaatcagttttggagtatctattagaatagctccaatactcgtcacagcgat 47340337  T
123 catgtaaattgaccaacataacactgaatctgatgataaccaaggtgttaatacactaatgacga 187  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
47340336 catgtaaattgaccaacataacactgaatctgatgataacc-aggtgttaatacactaatgacga 47340273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 253 - 354
Target Start/End: Complemental strand, 47340274 - 47340173
Alignment:
253 gacaagattacgatatctagtccagagatacccacagtggttagatcaccaaaattaaagtatcaccaagatacgcataatgattcaatattttggtgaa 352  Q
    |||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47340274 gacaagattacgatatctagtccagagatacccacaatggttagaccaccaaaattaaagtatcaccaagatacgcataatgattcaatattttggtgaa 47340175  T
353 at 354  Q
    ||    
47340174 at 47340173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University