View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11453_low_54 (Length: 294)

Name: NF11453_low_54
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11453_low_54
NF11453_low_54
[»] chr1 (3 HSPs)
chr1 (1-83)||(40603119-40603201)
chr1 (103-145)||(40603087-40603129)
chr1 (217-249)||(40602978-40603010)


Alignment Details
Target: chr1 (Bit Score: 79; Significance: 6e-37; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 40603201 - 40603119
Alignment:
1 tcaaggtttcaaacgccacccaaatatgaacaacttttgagctagaaaaatgtgatggtggctctcaccgtgcatggaaagtg 83  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40603201 tcaaagtttcaaacgccacccaaatatgaacaacttttgagctagaaaaatgtgatggtggctctcaccgtgcatggaaagtg 40603119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 103 - 145
Target Start/End: Complemental strand, 40603129 - 40603087
Alignment:
103 catgaaaagtgacggtggctttcatcgttggataataaaatac 145  Q
    |||| ||||||||||||||||||||||||||||||||||||||    
40603129 catggaaagtgacggtggctttcatcgttggataataaaatac 40603087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 217 - 249
Target Start/End: Complemental strand, 40603010 - 40602978
Alignment:
217 ccaccaaaccctatgaatatcattatatttaca 249  Q
    ||||||||| |||||||||||||||||||||||    
40603010 ccaccaaactctatgaatatcattatatttaca 40602978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University