View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11453_low_73 (Length: 249)

Name: NF11453_low_73
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11453_low_73
NF11453_low_73
[»] chr2 (1 HSPs)
chr2 (4-233)||(31910454-31910682)


Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 4 - 233
Target Start/End: Original strand, 31910454 - 31910682
Alignment:
4 tatgaaatacgaaaacaacttttatctcattttgtaacacaatttagactataaatagtcagttaattgcaaccaaaattgtgagaaaactgaagggaat 103  Q
    |||||||||||| |||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
31910454 tatgaaatacgagaacaacttttatctcattttataacacaatttagactatcaatagtcagttaattgcaaccaaaattgtgagaaaactgaagggaat 31910553  T
104 taagtcttcttctcaaagtaaccaaaatcacttaaaaatgacatgtatattaaaagttatacggaaaatactatcaagatgtccaaaatacgagttgaaa 203  Q
    |||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||| ||| ||    
31910554 taagtcttcttctcaatgtaactaaaatcacttaaaaatggcatgtatattaaaagttatacgg-aaatactatcaagatatccaaaatacgatttgcaa 31910652  T
204 tattttatataaatcaataaatttagcatg 233  Q
    ||||||||||||||||||||||||||||||    
31910653 tattttatataaatcaataaatttagcatg 31910682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University