View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453_low_77 (Length: 243)
Name: NF11453_low_77
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453_low_77 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 98 - 238
Target Start/End: Original strand, 29660908 - 29661048
Alignment:
| Q |
98 |
agtatattcattcgtgtagtgcagtccaatttctaccacctgcttcatggatccaaatctccatctataaattcattgaccacacataatgtccttcgat |
197 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29660908 |
agtatattcattcatgtagtgcagtccaatttctaccacctgcttcatggatccaaatctccatctataaattcattgaccacacataatgtccttcgat |
29661007 |
T |
|
| Q |
198 |
ttgtgatccactttgagactctttgctggtttcttctctct |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29661008 |
ttgtgatccactttgagactctttgctggtttcttatctct |
29661048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 29660760 - 29660860
Alignment:
| Q |
1 |
aaataaatctgttttcataagctagcataaagagcatatggaagtaatctggaaacaactcatgcatttgtcaaaaactatcttaaacaattccacaagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29660760 |
aaataaatctgttttcataagctagcataaagagcatatggaagtaatctggaaacaacccatgcatttgtcaaaaactatctcaaacaattccacaagt |
29660859 |
T |
|
| Q |
101 |
a |
101 |
Q |
| |
|
| |
|
|
| T |
29660860 |
a |
29660860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University