View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453_low_80 (Length: 242)
Name: NF11453_low_80
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453_low_80 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 18 - 112
Target Start/End: Original strand, 7323128 - 7323222
Alignment:
| Q |
18 |
ccatgtatgacgaactatggtggtgtcaaaggatgtcctttattactttctcccctacacacatgcacgatacccattatttccaacattgaaaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7323128 |
ccatgtatgacgaactatggtggtgtcaaaggatgtcctttattactttctcccctacacacatgcacgatacccattatttccaacattgaaaa |
7323222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 143 - 213
Target Start/End: Original strand, 7323721 - 7323791
Alignment:
| Q |
143 |
acattttccaaaaattgctcgtactttgttattactgccattacacattaattcaattggaagattccaat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7323721 |
acattttccaaaaattgctcgtactttgttatcactgccattacacattaattcaattggaagattccaat |
7323791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University