View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11453_low_81 (Length: 241)

Name: NF11453_low_81
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11453_low_81
NF11453_low_81
[»] chr7 (2 HSPs)
chr7 (1-106)||(32096426-32096531)
chr7 (170-225)||(32096595-32096650)


Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 32096426 - 32096531
Alignment:
1 aaacttcttaccaacattttaatattactaatgtctgtaggctgtagcatgaaagatctgaaatgaaactatgcataaaaattatagaataaaattgttc 100  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
32096426 aaacttcttaccaacattttaatattactaatgtatgtaggctgtagcatgaaagatctgaaatgaaactatgcataaaaattatagaataaaattgttt 32096525  T
101 atatct 106  Q
    ||||||    
32096526 atatct 32096531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 170 - 225
Target Start/End: Original strand, 32096595 - 32096650
Alignment:
170 ggctgatactggtttaacagtaaaggagacacccccaatttcaaaatggtcataaa 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32096595 ggctgatactggtttaacagtaaaggagacacccccaatttcaaaatggtcataaa 32096650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University