View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453_low_81 (Length: 241)
Name: NF11453_low_81
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453_low_81 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 32096426 - 32096531
Alignment:
| Q |
1 |
aaacttcttaccaacattttaatattactaatgtctgtaggctgtagcatgaaagatctgaaatgaaactatgcataaaaattatagaataaaattgttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32096426 |
aaacttcttaccaacattttaatattactaatgtatgtaggctgtagcatgaaagatctgaaatgaaactatgcataaaaattatagaataaaattgttt |
32096525 |
T |
 |
| Q |
101 |
atatct |
106 |
Q |
| |
|
|||||| |
|
|
| T |
32096526 |
atatct |
32096531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 170 - 225
Target Start/End: Original strand, 32096595 - 32096650
Alignment:
| Q |
170 |
ggctgatactggtttaacagtaaaggagacacccccaatttcaaaatggtcataaa |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32096595 |
ggctgatactggtttaacagtaaaggagacacccccaatttcaaaatggtcataaa |
32096650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University