View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453_low_82 (Length: 241)
Name: NF11453_low_82
Description: NF11453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453_low_82 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 31910205 - 31909986
Alignment:
| Q |
1 |
aaataggcattttaggtgcaatgtgtgtatgagaccaagttgttaaacttgtatttatagtacaatatgccttaaacttatgattatgcagtagtagtaa |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
31910205 |
aaataggcgttttaggtgcaatgtgtgtatgagacaaagttgttaaactagtatttatagtacaatatgccttaaacttatgattatgcggtagtaataa |
31910106 |
T |
|
| Q |
101 |
gataaaatagtaggaagaatgacatgtgtaattggtgatttatgttgaaattattataattatcatatgttggaacttcgaactggtttgataatagttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31910105 |
gataaaatagtaggaagaatgacatg------tggtgatttatgttgaaattactataattaccatatgttggaacttcgaactggtttgataatagttg |
31910012 |
T |
|
| Q |
201 |
actataattgatcatagaaactatat |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
31910011 |
actataattgatcatagaaactatat |
31909986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University